EMAIL THIS PAGE TO A FRIEND

CTSC

cathepsin C

121 Gene Product Result for
Synonyms: CPPI DPP-I DPP1 DPPI HMS JP JPD PALS PDON1 PLS
Gene ID:
Human(1075) Summary: The protein encoded by this gene, a member of the peptidase C1 family, is a lysosomal cysteine proteinase that appears to be a central coordinator for activation of many serine proteinases in immune/inflammatory cells. It is composed of a dimer of disulfide-linked heavy and light chains, both produced from a single protein precursor, and a residual portion of the propeptide acts as an intramolecular chaperone for the folding and stabilization of the mature enzyme. This enzyme requires chloride ions for activity and can degrade glucagon. Defects in the encoded protein have been shown to be a cause of Papillon-Lefevre syndrome, an autosomal recessive disorder characterized by palmoplantar keratosis and periodontitis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(13032) cathepsin C
Rat(25423) cathepsin C
Zebrafish(368704) cathepsin C
dog(403458) cathepsin C
cow(352958) cathepsin C
chicken(419014) cathepsin C
sheep(101112686) cathepsin C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001814 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001814 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001814 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009982 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009982 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009982 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU117831 MISSION® esiRNA esiRNA human AC020595.7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114173 Rosetta Predictions human pricing
NM_001814 Rosetta Predictions human pricing
NM_148170 Rosetta Predictions human pricing
NM_017097 Rosetta Predictions rat pricing
NM_009982 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326424 predicted 526
2 SASI_Hs02_00326425 predicted 837
3 SASI_Hs02_00326426 predicted 1016
4 SASI_Hs02_00326427 predicted 249
5 SASI_Hs02_00326428 predicted 867
6 SASI_Hs02_00326429 predicted 370
7 SASI_Hs02_00326430 predicted 552
8 SASI_Hs02_00326431 predicted 802
9 SASI_Hs02_00326432 predicted 668
10 SASI_Hs02_00326433 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001814 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243121 predicted 973
2 SASI_Hs01_00243123 predicted 658
3 SASI_Hs01_00243124 predicted 1564
4 SASI_Hs01_00243125 predicted 803
5 SASI_Hs01_00243126 predicted 601
6 SASI_Hs01_00243127 predicted 609
7 SASI_Hs01_00243128 predicted 1250
8 SASI_Hs01_00243129 predicted 1431
9 SASI_Hs02_00332597 predicted 897
10 SASI_Hs02_00332598 predicted 1164
11 SASI_Hs01_00243120 predicted 907
12 SASI_Hs01_00243122 predicted 965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148170 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138616 predicted 376
2 SASI_Hs01_00138615 predicted 497
3 SASI_Hs02_00365555 predicted 922
4 SASI_Hs01_00138618 predicted 597
5 SASI_Hs01_00138619 predicted 846
6 SASI_Hs01_00138621 predicted 709
7 SASI_Hs01_00138622 predicted 880
8 SASI_Hs01_00138623 predicted 588
9 SASI_Hs02_00365556 predicted 488
10 SASI_Hs02_00365557 predicted 350
11 SASI_Hs01_00138614 predicted 520
12 SASI_Hs01_00138617 predicted 982
13 SASI_Hs01_00138620 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017097 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033481 predicted 326
2 SASI_Rn01_00033482 predicted 1381
3 SASI_Rn01_00033483 predicted 298
4 SASI_Rn01_00033484 predicted 1025
5 SASI_Rn01_00033485 predicted 639
6 SASI_Rn01_00033486 predicted 967
7 SASI_Rn01_00033487 predicted 700
8 SASI_Rn01_00033488 predicted 1069
9 SASI_Rn01_00033489 predicted 319
10 SASI_Rn01_00033490 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009982 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317576 predicted 1107
2 SASI_Mm01_00116549 predicted 874
3 SASI_Mm01_00116550 predicted 830
4 SASI_Mm01_00116551 predicted 1119
5 SASI_Mm02_00317577 predicted 916
6 SASI_Mm01_00116552 predicted 891
7 SASI_Mm01_00116553 predicted 301
8 SASI_Mm01_00116554 predicted 593
9 SASI_Mm01_00116555 predicted 1343
10 SASI_Mm01_00116556 predicted 1359
11 SASI_Mm01_00116547 predicted 1067
12 SASI_Mm01_00116548 predicted 1474
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001814
VALIDATED
CTSC MISSION shRNA Bacterial Glycerol Stock
cathepsin C
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001814.x-868s1c1
Sequence:CCGGGCTGCTACTCATTTGCTTCTACTCGAGTAGAAGCAAATGAGTAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001814.x-1647s1c1
Sequence:CCGGTATACCTTTCAATCGGCCACTCTCGAGAGTGGCCGATTGAAAGGTATATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001814.x-416s1c1
Sequence:CCGGGTATAAAGAAGAGGGCAGCAACTCGAGTTGCTGCCCTCTTCTTTATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001814.x-1230s1c1
Sequence:CCGGGATGACTTCCTCCACTACAAACTCGAGTTTGTAGTGGAGGAAGTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001814.x-1017s1c1
Sequence:CCGGGCAGGAAAGTACGCCCAAGATCTCGAGATCTTGGGCGTACTTTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001814.4-1233s21c1
Sequence:CCGGGATGACTTCCTCCACTACAAACTCGAGTTTGTAGTGGAGGAAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001814.4-871s21c1
Sequence:CCGGGCTGCTACTCATTTGCTTCTACTCGAGTAGAAGCAAATGAGTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001814.4-1020s21c1
Sequence:CCGGGCAGGAAAGTACGCCCAAGATCTCGAGATCTTGGGCGTACTTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001814.4-1650s21c1
Sequence:CCGGTATACCTTTCAATCGGCCACTCTCGAGAGTGGCCGATTGAAAGGTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001814
VALIDATED
CTSC MISSION shRNA shRNA Plasmid DNA
cathepsin C
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001814.x-868s1c1
Sequence:CCGGGCTGCTACTCATTTGCTTCTACTCGAGTAGAAGCAAATGAGTAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001814.x-1647s1c1
Sequence:CCGGTATACCTTTCAATCGGCCACTCTCGAGAGTGGCCGATTGAAAGGTATATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001814.x-416s1c1
Sequence:CCGGGTATAAAGAAGAGGGCAGCAACTCGAGTTGCTGCCCTCTTCTTTATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001814.x-1230s1c1
Sequence:CCGGGATGACTTCCTCCACTACAAACTCGAGTTTGTAGTGGAGGAAGTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001814.x-1017s1c1
Sequence:CCGGGCAGGAAAGTACGCCCAAGATCTCGAGATCTTGGGCGTACTTTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001814.4-1233s21c1
Sequence:CCGGGATGACTTCCTCCACTACAAACTCGAGTTTGTAGTGGAGGAAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001814.4-871s21c1
Sequence:CCGGGCTGCTACTCATTTGCTTCTACTCGAGTAGAAGCAAATGAGTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001814.4-1020s21c1
Sequence:CCGGGCAGGAAAGTACGCCCAAGATCTCGAGATCTTGGGCGTACTTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001814.4-1650s21c1
Sequence:CCGGTATACCTTTCAATCGGCCACTCTCGAGAGTGGCCGATTGAAAGGTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001814
VALIDATED
CTSC MISSION shRNA Lentiviral Transduction Particles
cathepsin C
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001814.x-868s1c1
Sequence:CCGGGCTGCTACTCATTTGCTTCTACTCGAGTAGAAGCAAATGAGTAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001814.x-1647s1c1
Sequence:CCGGTATACCTTTCAATCGGCCACTCTCGAGAGTGGCCGATTGAAAGGTATATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001814.x-416s1c1
Sequence:CCGGGTATAAAGAAGAGGGCAGCAACTCGAGTTGCTGCCCTCTTCTTTATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001814.x-1230s1c1
Sequence:CCGGGATGACTTCCTCCACTACAAACTCGAGTTTGTAGTGGAGGAAGTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001814.x-1017s1c1
Sequence:CCGGGCAGGAAAGTACGCCCAAGATCTCGAGATCTTGGGCGTACTTTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001814.4-1233s21c1
Sequence:CCGGGATGACTTCCTCCACTACAAACTCGAGTTTGTAGTGGAGGAAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001814.4-871s21c1
Sequence:CCGGGCTGCTACTCATTTGCTTCTACTCGAGTAGAAGCAAATGAGTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001814.4-1020s21c1
Sequence:CCGGGCAGGAAAGTACGCCCAAGATCTCGAGATCTTGGGCGTACTTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001814.4-1650s21c1
Sequence:CCGGTATACCTTTCAATCGGCCACTCTCGAGAGTGGCCGATTGAAAGGTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009982
VALIDATED
CTSC MISSION shRNA Bacterial Glycerol Stock
cathepsin C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009982.2-219s1c1
Sequence:CCGGCGACATTAACTGCTCGGTGATCTCGAGATCACCGAGCAGTTAATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009982.2-324s1c1
Sequence:CCGGCCTCATTTACAACCAAGGCTTCTCGAGAAGCCTTGGTTGTAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009982.2-1080s1c1
Sequence:CCGGCCGTTACTATTCTTCTGACTACTCGAGTAGTCAGAAGAATAGTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009982.2-1436s1c1
Sequence:CCGGCCATACCGATTCCTAAATTATCTCGAGATAATTTAGGAATCGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009982.2-1298s1c1
Sequence:CCGGGCTATGGAAGAGATCCAGTTACTCGAGTAACTGGATCTCTTCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009982
VALIDATED
CTSC MISSION shRNA shRNA Plasmid DNA
cathepsin C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009982.2-219s1c1
Sequence:CCGGCGACATTAACTGCTCGGTGATCTCGAGATCACCGAGCAGTTAATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009982.2-324s1c1
Sequence:CCGGCCTCATTTACAACCAAGGCTTCTCGAGAAGCCTTGGTTGTAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009982.2-1080s1c1
Sequence:CCGGCCGTTACTATTCTTCTGACTACTCGAGTAGTCAGAAGAATAGTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009982.2-1436s1c1
Sequence:CCGGCCATACCGATTCCTAAATTATCTCGAGATAATTTAGGAATCGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009982.2-1298s1c1
Sequence:CCGGGCTATGGAAGAGATCCAGTTACTCGAGTAACTGGATCTCTTCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009982
VALIDATED
CTSC MISSION shRNA Lentiviral Transduction Particles
cathepsin C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009982.2-219s1c1
Sequence:CCGGCGACATTAACTGCTCGGTGATCTCGAGATCACCGAGCAGTTAATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009982.2-324s1c1
Sequence:CCGGCCTCATTTACAACCAAGGCTTCTCGAGAAGCCTTGGTTGTAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009982.2-1080s1c1
Sequence:CCGGCCGTTACTATTCTTCTGACTACTCGAGTAGTCAGAAGAATAGTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009982.2-1436s1c1
Sequence:CCGGCCATACCGATTCCTAAATTATCTCGAGATAATTTAGGAATCGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009982.2-1298s1c1
Sequence:CCGGGCTATGGAAGAGATCCAGTTACTCGAGTAACTGGATCTCTTCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks