EMAIL THIS PAGE TO A FRIEND

CTSD

cathepsin D

71 Gene Product Result for
Synonyms: CLN10 CPSD
UniProtKB ID: P07339, Q6IB57
Gene ID:
Human(1509) Summary: This gene encodes a lysosomal aspartyl protease composed of a dimer of disulfide-linked heavy and light chains, both produced from a single protein precursor. This proteinase, which is a member of the peptidase C1 family, has a specificity similar to but narrower than that of pepsin A. Transcription of this gene is initiated from several sites, including one which is a start site for an estrogen-regulated transcript. Mutations in this gene are involved in the pathogenesis of several diseases, including breast cancer and possibly Alzheimer disease. [provided by RefSeq, Jul 2008]
Mouse(13033) cathepsin D
Rat(171293) cathepsin D
sheep(443060) cathepsin D
Zebrafish(65225) cathepsin D
cow(282883) cathepsin D
Horse(100033994) cathepsin D
dog(483662) cathepsin D
chicken(396090) cathepsin D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Activity Assay

Product # Description Species Add to Cart
 
CS0800 Cathepsin D Assay Kit sufficient for 120 assays (100 μL) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009983 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009983 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009983 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001909 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001909 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001909 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001909 Rosetta Predictions human pricing
NM_134334 Rosetta Predictions rat pricing
NM_009983 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001909 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332783 predicted 473
2 SASI_Hs01_00141231 predicted 1148
3 SASI_Hs01_00141234 predicted 1307
4 SASI_Hs02_00332784 predicted 611
5 SASI_Hs02_00332785 predicted 395
6 SASI_Hs01_00141238 predicted 1088
7 SASI_Hs01_00141240 predicted 856
8 SASI_Hs02_00332786 predicted 532
9 SASI_Hs02_00332787 predicted 885
10 SASI_Hs02_00332788 predicted 1153
11 SASI_Hs01_00141232 predicted 647
12 SASI_Hs01_00141233 predicted 327
13 SASI_Hs01_00141235 predicted 1622
14 SASI_Hs01_00141236 predicted 503
15 SASI_Hs01_00141237 predicted 1837
16 SASI_Hs01_00141239 predicted 1691
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134334 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031929 predicted 378
2 SASI_Rn01_00031930 predicted 1256
3 SASI_Rn01_00031931 predicted 475
4 SASI_Rn02_00267889 predicted 1159
5 SASI_Rn01_00031932 predicted 651
6 SASI_Rn01_00031933 predicted 1276
7 SASI_Rn01_00031934 predicted 1101
8 SASI_Rn01_00031935 predicted 510
9 SASI_Rn01_00031936 predicted 1110
10 SASI_Rn01_00031937 predicted 277
11 SASI_Rn01_00031928 predicted 604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009983 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144776 predicted 529
2 SASI_Mm02_00317578 predicted 383
3 SASI_Mm01_00144777 predicted 1382
4 SASI_Mm01_00144778 predicted 668
5 SASI_Mm01_00144779 predicted 1097
6 SASI_Mm01_00144781 predicted 1119
7 SASI_Mm01_00144782 predicted 1273
8 SASI_Mm01_00144783 predicted 925
9 SASI_Mm01_00144784 predicted 742
10 SASI_Mm01_00144785 predicted 1286
11 SASI_Mm01_00144780 predicted 589
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009983
VALIDATED
CTSD MISSION shRNA Bacterial Glycerol Stock
cathepsin D
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009983.2-382s21c1
Sequence:CCGGCCCTCCATTCATTGCAAGATACTCGAGTATCTTGCAATGAATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009983.2-1015s21c1
Sequence:CCGGCCTCTTATCCAGGGTGAGTATCTCGAGATACTCACCCTGGATAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009983.2-262s21c1
Sequence:CCGGCCAGTGTCAGAGTTACTCAAACTCGAGTTTGAGTAACTCTGACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009983.2-669s21c1
Sequence:CCGGCCCTCATATCTCTGTTAACAACTCGAGTTGTTAACAGAGATATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009983.2-382s1c1
Sequence:CCGGCCCTCCATTCATTGCAAGATACTCGAGTATCTTGCAATGAATGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009983.2-669s1c1
Sequence:CCGGCCCTCATATCTCTGTTAACAACTCGAGTTGTTAACAGAGATATGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009983.2-1015s1c1
Sequence:CCGGCCTCTTATCCAGGGTGAGTATCTCGAGATACTCACCCTGGATAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009983.2-1258s1c1
Sequence:CCGGGACAACAATAGGGTCGGCTTTCTCGAGAAAGCCGACCCTATTGTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009983.2-262s1c1
Sequence:CCGGCCAGTGTCAGAGTTACTCAAACTCGAGTTTGAGTAACTCTGACACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009983
VALIDATED
CTSD MISSION shRNA shRNA Plasmid DNA
cathepsin D
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009983.2-382s21c1
Sequence:CCGGCCCTCCATTCATTGCAAGATACTCGAGTATCTTGCAATGAATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009983.2-1015s21c1
Sequence:CCGGCCTCTTATCCAGGGTGAGTATCTCGAGATACTCACCCTGGATAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009983.2-262s21c1
Sequence:CCGGCCAGTGTCAGAGTTACTCAAACTCGAGTTTGAGTAACTCTGACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009983.2-669s21c1
Sequence:CCGGCCCTCATATCTCTGTTAACAACTCGAGTTGTTAACAGAGATATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009983.2-382s1c1
Sequence:CCGGCCCTCCATTCATTGCAAGATACTCGAGTATCTTGCAATGAATGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009983.2-669s1c1
Sequence:CCGGCCCTCATATCTCTGTTAACAACTCGAGTTGTTAACAGAGATATGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009983.2-1015s1c1
Sequence:CCGGCCTCTTATCCAGGGTGAGTATCTCGAGATACTCACCCTGGATAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009983.2-1258s1c1
Sequence:CCGGGACAACAATAGGGTCGGCTTTCTCGAGAAAGCCGACCCTATTGTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009983.2-262s1c1
Sequence:CCGGCCAGTGTCAGAGTTACTCAAACTCGAGTTTGAGTAACTCTGACACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009983
VALIDATED
CTSD MISSION shRNA Lentiviral Transduction Particles
cathepsin D
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009983.2-382s21c1
Sequence:CCGGCCCTCCATTCATTGCAAGATACTCGAGTATCTTGCAATGAATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009983.2-1015s21c1
Sequence:CCGGCCTCTTATCCAGGGTGAGTATCTCGAGATACTCACCCTGGATAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009983.2-262s21c1
Sequence:CCGGCCAGTGTCAGAGTTACTCAAACTCGAGTTTGAGTAACTCTGACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009983.2-669s21c1
Sequence:CCGGCCCTCATATCTCTGTTAACAACTCGAGTTGTTAACAGAGATATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009983.2-382s1c1
Sequence:CCGGCCCTCCATTCATTGCAAGATACTCGAGTATCTTGCAATGAATGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009983.2-669s1c1
Sequence:CCGGCCCTCATATCTCTGTTAACAACTCGAGTTGTTAACAGAGATATGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009983.2-1015s1c1
Sequence:CCGGCCTCTTATCCAGGGTGAGTATCTCGAGATACTCACCCTGGATAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009983.2-1258s1c1
Sequence:CCGGGACAACAATAGGGTCGGCTTTCTCGAGAAAGCCGACCCTATTGTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009983.2-262s1c1
Sequence:CCGGCCAGTGTCAGAGTTACTCAAACTCGAGTTTGAGTAACTCTGACACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001909
VALIDATED
CTSD MISSION shRNA Bacterial Glycerol Stock
cathepsin D
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001909.3-694s21c1
Sequence:CCGGCATCACCTTCATCGCAGCCAACTCGAGTTGGCTGCGATGAAGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001909.3-539s21c1
Sequence:CCGGACCTCGTTTGACATCCACTATCTCGAGATAGTGGATGTCAAACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001909.3-1780s21c1
Sequence:CCGGTTGGAAACCTGCCCTGCCTGACTCGAGTCAGGCAGGGCAGGTTTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001909.3-208s21c1
Sequence:CCGGGCTGCACAAGTTCACGTCCATCTCGAGATGGACGTGAACTTGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001909.x-539s1c1
Sequence:CCGGACCTCGTTTGACATCCACTATCTCGAGATAGTGGATGTCAAACGAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001909.x-643s1c1
Sequence:CCGGCGGTGTCAAAGTGGAGAGGCACTCGAGTGCCTCTCCACTTTGACACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001909.x-694s1c1
Sequence:CCGGCATCACCTTCATCGCAGCCAACTCGAGTTGGCTGCGATGAAGGTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003664    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001909.x-1780s1c1
Sequence:CCGGTTGGAAACCTGCCCTGCCTGACTCGAGTCAGGCAGGGCAGGTTTCCAATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001909.x-208s1c1
Sequence:CCGGGCTGCACAAGTTCACGTCCATCTCGAGATGGACGTGAACTTGTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001909
VALIDATED
CTSD MISSION shRNA shRNA Plasmid DNA
cathepsin D
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001909.3-694s21c1
Sequence:CCGGCATCACCTTCATCGCAGCCAACTCGAGTTGGCTGCGATGAAGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001909.3-539s21c1
Sequence:CCGGACCTCGTTTGACATCCACTATCTCGAGATAGTGGATGTCAAACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001909.3-1780s21c1
Sequence:CCGGTTGGAAACCTGCCCTGCCTGACTCGAGTCAGGCAGGGCAGGTTTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001909.3-208s21c1
Sequence:CCGGGCTGCACAAGTTCACGTCCATCTCGAGATGGACGTGAACTTGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001909.x-539s1c1
Sequence:CCGGACCTCGTTTGACATCCACTATCTCGAGATAGTGGATGTCAAACGAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001909.x-643s1c1
Sequence:CCGGCGGTGTCAAAGTGGAGAGGCACTCGAGTGCCTCTCCACTTTGACACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001909.x-694s1c1
Sequence:CCGGCATCACCTTCATCGCAGCCAACTCGAGTTGGCTGCGATGAAGGTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003664    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001909.x-1780s1c1
Sequence:CCGGTTGGAAACCTGCCCTGCCTGACTCGAGTCAGGCAGGGCAGGTTTCCAATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001909.x-208s1c1
Sequence:CCGGGCTGCACAAGTTCACGTCCATCTCGAGATGGACGTGAACTTGTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001909
VALIDATED
CTSD MISSION shRNA Lentiviral Transduction Particles
cathepsin D
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001909.3-694s21c1
Sequence:CCGGCATCACCTTCATCGCAGCCAACTCGAGTTGGCTGCGATGAAGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001909.3-539s21c1
Sequence:CCGGACCTCGTTTGACATCCACTATCTCGAGATAGTGGATGTCAAACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001909.3-1780s21c1
Sequence:CCGGTTGGAAACCTGCCCTGCCTGACTCGAGTCAGGCAGGGCAGGTTTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001909.3-208s21c1
Sequence:CCGGGCTGCACAAGTTCACGTCCATCTCGAGATGGACGTGAACTTGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001909.x-539s1c1
Sequence:CCGGACCTCGTTTGACATCCACTATCTCGAGATAGTGGATGTCAAACGAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001909.x-643s1c1
Sequence:CCGGCGGTGTCAAAGTGGAGAGGCACTCGAGTGCCTCTCCACTTTGACACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001909.x-694s1c1
Sequence:CCGGCATCACCTTCATCGCAGCCAACTCGAGTTGGCTGCGATGAAGGTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003664    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001909.x-1780s1c1
Sequence:CCGGTTGGAAACCTGCCCTGCCTGACTCGAGTCAGGCAGGGCAGGTTTCCAATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001909.x-208s1c1
Sequence:CCGGGCTGCACAAGTTCACGTCCATCTCGAGATGGACGTGAACTTGTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks