EMAIL THIS PAGE TO A FRIEND

CTSE

cathepsin E

126 Gene Product Result for
Synonyms: CATE
UniProtKB ID: P14091, Q5TZ01, Q5TZ02, Q9NY58, Q9UCE3, Q9UCE4
Gene ID:
Human(1510) Summary: The protein encoded by this gene is a gastric aspartyl protease that functions as a disulfide-linked homodimer. This protease, which is a member of the peptidase C1 family, has a specificity similar to that of pepsin A and cathepsin D. It is an intracellular proteinase that does not appear to be involved in the digestion of dietary protein and is found in highest concentration in the surface of epithelial mucus-producing cells of the stomach. It is the first aspartic proteinase expressed in the fetal stomach and is found in more than half of gastric cancers. It appears, therefore, to be an oncofetal antigen. Transcript variants utilizing alternative polyadenylation signals and two transcript variants encoding different isoforms exist for this gene. [provided by RefSeq, Jul 2008]
Mouse(13034) cathepsin E
Rat(25424) cathepsin E
chicken(771791) cathepsin E
Horse(100055161) cathepsin E
cow(281106) cathepsin E
dog(488577) cathepsin E
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Substrate

Product # Description Species Add to Cart
 
M0938 7-Methoxycoumarin-4-Acetyl-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-Leu-Lys(DNP)-D-Arg-amide >97% (HPLC), solid human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001910 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001910 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001910 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007799 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007799 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007799 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU158571 MISSION® esiRNA esiRNA human CTSE (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001910 Rosetta Predictions human pricing
NM_148964 Rosetta Predictions human pricing
NM_012938 Rosetta Predictions rat pricing
NM_007799 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001910 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170959 predicted 639
2 SASI_Hs01_00170960 predicted 560
3 SASI_Hs02_00332789 predicted 568
4 SASI_Hs01_00170961 predicted 321
5 SASI_Hs01_00170963 predicted 542
6 SASI_Hs01_00170964 predicted 514
7 SASI_Hs01_00170965 predicted 258
8 SASI_Hs01_00170966 predicted 349
9 SASI_Hs01_00170968 predicted 585
10 SASI_Hs02_00332790 predicted 492
11 SASI_Hs01_00170962 predicted 646
12 SASI_Hs01_00170967 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148964 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112094 predicted 648
2 SASI_Hs01_00112095 predicted 564
3 SASI_Hs02_00365683 predicted 568
4 SASI_Hs01_00112096 predicted 329
5 SASI_Hs01_00112098 predicted 535
6 SASI_Hs01_00112099 predicted 506
7 SASI_Hs01_00112100 predicted 260
8 SASI_Hs01_00112101 predicted 355
9 SASI_Hs01_00112103 predicted 592
10 SASI_Hs02_00365684 predicted 488
11 SASI_Hs01_00112097 predicted 644
12 SASI_Hs01_00112102 predicted 660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012938 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092137 predicted 772
2 SASI_Rn01_00092138 predicted 1327
3 SASI_Rn02_00260503 predicted 1248
4 SASI_Rn01_00092139 predicted 467
5 SASI_Rn01_00092141 predicted 1305
6 SASI_Rn01_00092142 predicted 1288
7 SASI_Rn01_00092143 predicted 1348
8 SASI_Rn01_00092144 predicted 755
9 SASI_Rn01_00092145 predicted 732
10 SASI_Rn01_00092146 predicted 581
11 SASI_Rn01_00092140 predicted 1309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007799 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312490 predicted 809
2 SASI_Mm01_00125002 predicted 1336
3 SASI_Mm01_00125001 predicted 1369
4 SASI_Mm01_00125003 predicted 1428
5 SASI_Mm01_00125004 predicted 642
6 SASI_Mm01_00125005 predicted 741
7 SASI_Mm01_00125006 predicted 960
8 SASI_Mm02_00312491 predicted 1276
9 SASI_Mm02_00312492 predicted 1320
10 SASI_Mm02_00312493 predicted 1011
11 SASI_Mm01_00124997 predicted 1141
12 SASI_Mm01_00124998 predicted 630
13 SASI_Mm01_00124999 predicted 1124
14 SASI_Mm01_00125000 predicted 887
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001910
CTSE MISSION shRNA Bacterial Glycerol Stock
cathepsin E
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001910.x-1268s1c1
Sequence:CCGGCGTGGGAATAACCGTGTGGGACTCGAGTCCCACACGGTTATTCCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001910.x-742s1c1
Sequence:CCGGCCTGGTGGACTTGCCGATGTTCTCGAGAACATCGGCAAGTCCACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001910.x-1624s1c1
Sequence:CCGGGCACAAGCAGAGATCATGGTACTCGAGTACCATGATCTCTGCTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001910.x-991s1c1
Sequence:CCGGCGACAAGATTAAGCAGCTGCACTCGAGTGCAGCTGCTTAATCTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001910.x-1057s1c1
Sequence:CCGGGTGTGCCAACCTTAACGTCATCTCGAGATGACGTTAAGGTTGGCACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001910.2-983s21c1
Sequence:CCGGGGCCCTTCCGACAAGATTAAGCTCGAGCTTAATCTTGTCGGAAGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001910.2-249s21c1
Sequence:GTACCGGAGTTCTGGAAATCCCATAATTCTCGAGAATTATGGGATTTCCAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001910.2-1051s21c1
Sequence:CCGGTGTGGAGTGTGCCAACCTTAACTCGAGTTAAGGTTGGCACACTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001910.2-1081s21c1
Sequence:CCGGGGATGTCACCTTCACCATTAACTCGAGTTAATGGTGAAGGTGACATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001910.2-1901s21c1
Sequence:CCGGATTCAAGCAAGGCCCATATATCTCGAGATATATGGGCCTTGCTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001910
CTSE MISSION shRNA shRNA Plasmid DNA
cathepsin E
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001910.x-1268s1c1
Sequence:CCGGCGTGGGAATAACCGTGTGGGACTCGAGTCCCACACGGTTATTCCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001910.x-742s1c1
Sequence:CCGGCCTGGTGGACTTGCCGATGTTCTCGAGAACATCGGCAAGTCCACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001910.x-1624s1c1
Sequence:CCGGGCACAAGCAGAGATCATGGTACTCGAGTACCATGATCTCTGCTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001910.x-991s1c1
Sequence:CCGGCGACAAGATTAAGCAGCTGCACTCGAGTGCAGCTGCTTAATCTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001910.x-1057s1c1
Sequence:CCGGGTGTGCCAACCTTAACGTCATCTCGAGATGACGTTAAGGTTGGCACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001910.2-983s21c1
Sequence:CCGGGGCCCTTCCGACAAGATTAAGCTCGAGCTTAATCTTGTCGGAAGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001910.2-249s21c1
Sequence:GTACCGGAGTTCTGGAAATCCCATAATTCTCGAGAATTATGGGATTTCCAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001910.2-1051s21c1
Sequence:CCGGTGTGGAGTGTGCCAACCTTAACTCGAGTTAAGGTTGGCACACTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001910.2-1081s21c1
Sequence:CCGGGGATGTCACCTTCACCATTAACTCGAGTTAATGGTGAAGGTGACATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001910.2-1901s21c1
Sequence:CCGGATTCAAGCAAGGCCCATATATCTCGAGATATATGGGCCTTGCTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001910
CTSE MISSION shRNA Lentiviral Transduction Particles
cathepsin E
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001910.x-1268s1c1
Sequence:CCGGCGTGGGAATAACCGTGTGGGACTCGAGTCCCACACGGTTATTCCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001910.x-742s1c1
Sequence:CCGGCCTGGTGGACTTGCCGATGTTCTCGAGAACATCGGCAAGTCCACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001910.x-1624s1c1
Sequence:CCGGGCACAAGCAGAGATCATGGTACTCGAGTACCATGATCTCTGCTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001910.x-991s1c1
Sequence:CCGGCGACAAGATTAAGCAGCTGCACTCGAGTGCAGCTGCTTAATCTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001910.x-1057s1c1
Sequence:CCGGGTGTGCCAACCTTAACGTCATCTCGAGATGACGTTAAGGTTGGCACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001910.2-983s21c1
Sequence:CCGGGGCCCTTCCGACAAGATTAAGCTCGAGCTTAATCTTGTCGGAAGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001910.2-249s21c1
Sequence:GTACCGGAGTTCTGGAAATCCCATAATTCTCGAGAATTATGGGATTTCCAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001910.2-1051s21c1
Sequence:CCGGTGTGGAGTGTGCCAACCTTAACTCGAGTTAAGGTTGGCACACTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001910.2-1081s21c1
Sequence:CCGGGGATGTCACCTTCACCATTAACTCGAGTTAATGGTGAAGGTGACATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001910.2-1901s21c1
Sequence:CCGGATTCAAGCAAGGCCCATATATCTCGAGATATATGGGCCTTGCTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007799
CTSE MISSION shRNA Bacterial Glycerol Stock
cathepsin E
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007799.2-1238s1c1
Sequence:CCGGCCCGACAAGATCAAACATCTTCTCGAGAAGATGTTTGATCTTGTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007799.2-1493s1c1
Sequence:CCGGCGACAGTTCTACTCAGTCTTTCTCGAGAAAGACTGAGTAGAACTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007799.2-537s1c1
Sequence:CCGGGCGAGTCCTGTAATGTGTATTCTCGAGAATACACATTACAGGACTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007799.2-631s1c1
Sequence:CCGGGCAGAACTTCACTGTCATCTTCTCGAGAAGATGACAGTGAAGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007799.2-1351s1c1
Sequence:CCGGCGAGGTTTCATATACCCTCAACTCGAGTTGAGGGTATATGAAACCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007799
CTSE MISSION shRNA shRNA Plasmid DNA
cathepsin E
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007799.2-1238s1c1
Sequence:CCGGCCCGACAAGATCAAACATCTTCTCGAGAAGATGTTTGATCTTGTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007799.2-1493s1c1
Sequence:CCGGCGACAGTTCTACTCAGTCTTTCTCGAGAAAGACTGAGTAGAACTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007799.2-537s1c1
Sequence:CCGGGCGAGTCCTGTAATGTGTATTCTCGAGAATACACATTACAGGACTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007799.2-631s1c1
Sequence:CCGGGCAGAACTTCACTGTCATCTTCTCGAGAAGATGACAGTGAAGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007799.2-1351s1c1
Sequence:CCGGCGAGGTTTCATATACCCTCAACTCGAGTTGAGGGTATATGAAACCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007799
CTSE MISSION shRNA Lentiviral Transduction Particles
cathepsin E
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007799.2-1238s1c1
Sequence:CCGGCCCGACAAGATCAAACATCTTCTCGAGAAGATGTTTGATCTTGTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007799.2-1493s1c1
Sequence:CCGGCGACAGTTCTACTCAGTCTTTCTCGAGAAAGACTGAGTAGAACTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007799.2-537s1c1
Sequence:CCGGGCGAGTCCTGTAATGTGTATTCTCGAGAATACACATTACAGGACTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007799.2-631s1c1
Sequence:CCGGGCAGAACTTCACTGTCATCTTCTCGAGAAGATGACAGTGAAGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007799.2-1351s1c1
Sequence:CCGGCGAGGTTTCATATACCCTCAACTCGAGTTGAGGGTATATGAAACCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks