EMAIL THIS PAGE TO A FRIEND

CTSF

cathepsin F

52 Gene Product Result for
Synonyms: CATSF CLN13
UniProtKB ID: Q9UBX1, B2R964, O95240, Q9NSU4, Q9UKQ5
Gene ID:
Human(8722) Summary: Cathepsins are papain family cysteine proteinases that represent a major component of the lysosomal proteolytic system. Cathepsins generally contain a signal sequence, followed by a propeptide and then a catalytically active mature region. The very long (251 amino acid residues) proregion of the cathepsin F precursor contains a C-terminal domain similar to the pro-segment of cathepsin L-like enzymes, a 50-residue flexible linker peptide, and an N-terminal domain predicted to adopt a cystatin-like fold. The cathepsin F proregion is unique within the papain family cysteine proteases in that it contains this additional N-terminal segment predicted to share structural similarities with cysteine protease inhibitors of the cystatin superfamily. This cystatin-like domain contains some of the elements known to be important for inhibitory activity. CTSF encodes a predicted protein of 484 amino acids which contains a 19 residue signal peptide. Cathepsin F contains five potential N-glycosylation sites, and it may be targeted to the endosomal/lysosomal compartment via the mannose 6-phosphate receptor pathway. The cathepsin F gene is ubiquitously expressed, and it maps to chromosome 11q13, close to the gene encoding cathepsin W. [provided by RefSeq, Jul 2008]
Mouse(56464) cathepsin F
Rat(361704) cathepsin F
sheep(780471) cathepsin F
Zebrafish(565588) cathepsin F
cow(509715) cathepsin F
Horse(100058569) cathepsin F
dog(476010) cathepsin F
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019861 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019861 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019861 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003793 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003793 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003793 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003793 Rosetta Predictions human pricing
NM_001034110 Rosetta Predictions rat pricing
NM_019861 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003793 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014433 predicted 648
2 SASI_Hs01_00014434 predicted 673
3 SASI_Hs01_00014435 predicted 656
4 SASI_Hs01_00014436 predicted 1297
5 SASI_Hs01_00014437 predicted 624
6 SASI_Hs01_00014438 predicted 1745
7 SASI_Hs01_00014439 predicted 568
8 SASI_Hs01_00014441 predicted 815
9 SASI_Hs02_00336304 predicted 563
10 SASI_Hs02_00336305 predicted 672
11 SASI_Hs01_00014440 predicted 1177
12 SASI_Hs01_00014442 predicted 1794
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034110 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054652 predicted 745
2 SASI_Rn01_00054653 predicted 1053
3 SASI_Rn01_00054654 predicted 544
4 SASI_Rn01_00054656 predicted 1188
5 SASI_Rn01_00054658 predicted 1159
6 SASI_Rn01_00054659 predicted 1164
7 SASI_Rn01_00054660 predicted 516
8 SASI_Rn02_00203950 predicted 528
9 SASI_Rn01_00054661 predicted 501
10 SASI_Rn02_00203951 predicted 646
11 SASI_Rn01_00054655 predicted 668
12 SASI_Rn01_00054657 predicted 1303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019861 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073436 predicted 774
2 SASI_Mm01_00073437 predicted 555
3 SASI_Mm01_00073438 predicted 1266
4 SASI_Mm01_00073439 predicted 1258
5 SASI_Mm01_00073440 predicted 642
6 SASI_Mm01_00073441 predicted 1406
7 SASI_Mm01_00073442 predicted 712
8 SASI_Mm01_00073443 predicted 1150
9 SASI_Mm01_00073444 predicted 696
10 SASI_Mm01_00073445 predicted 842
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019861
VALIDATED
CTSF MISSION shRNA Bacterial Glycerol Stock
cathepsin F
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349999    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019861.1-1788s21c1
Sequence:CCGGCAAGAACCTGGCTACAGTATGCTCGAGCATACTGTAGCCAGGTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019861.1-686s21c1
Sequence:CCGGCAGTGGCGATTGACTGTCTTTCTCGAGAAAGACAGTCAATCGCCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019861.1-863s21c1
Sequence:CCGGGCCAAGTCCATAAATGATCTTCTCGAGAAGATCATTTATGGACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019861.1-647s21c1
Sequence:CCGGACCACCTATAACCGGACTTATCTCGAGATAAGTCCGGTTATAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019861.1-280s21c1
Sequence:CCGGCGCGCTGGACATGTACAATTACTCGAGTAATTGTACATGTCCAGCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019861.1-863s1c1
Sequence:CCGGGCCAAGTCCATAAATGATCTTCTCGAGAAGATCATTTATGGACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019861.1-280s1c1
Sequence:CCGGCGCGCTGGACATGTACAATTACTCGAGTAATTGTACATGTCCAGCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019861.1-686s1c1
Sequence:CCGGCAGTGGCGATTGACTGTCTTTCTCGAGAAAGACAGTCAATCGCCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019861.1-554s1c1
Sequence:CCGGGCGACTTTCAGCTCATTCCTTCTCGAGAAGGAATGAGCTGAAAGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019861.1-1390s1c1
Sequence:CCGGCAACCGCTCTAACATTCCTTACTCGAGTAAGGAATGTTAGAGCGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019861
VALIDATED
CTSF MISSION shRNA shRNA Plasmid DNA
cathepsin F
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349999    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019861.1-1788s21c1
Sequence:CCGGCAAGAACCTGGCTACAGTATGCTCGAGCATACTGTAGCCAGGTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019861.1-686s21c1
Sequence:CCGGCAGTGGCGATTGACTGTCTTTCTCGAGAAAGACAGTCAATCGCCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019861.1-863s21c1
Sequence:CCGGGCCAAGTCCATAAATGATCTTCTCGAGAAGATCATTTATGGACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019861.1-647s21c1
Sequence:CCGGACCACCTATAACCGGACTTATCTCGAGATAAGTCCGGTTATAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019861.1-280s21c1
Sequence:CCGGCGCGCTGGACATGTACAATTACTCGAGTAATTGTACATGTCCAGCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019861.1-863s1c1
Sequence:CCGGGCCAAGTCCATAAATGATCTTCTCGAGAAGATCATTTATGGACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019861.1-280s1c1
Sequence:CCGGCGCGCTGGACATGTACAATTACTCGAGTAATTGTACATGTCCAGCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019861.1-686s1c1
Sequence:CCGGCAGTGGCGATTGACTGTCTTTCTCGAGAAAGACAGTCAATCGCCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019861.1-554s1c1
Sequence:CCGGGCGACTTTCAGCTCATTCCTTCTCGAGAAGGAATGAGCTGAAAGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019861.1-1390s1c1
Sequence:CCGGCAACCGCTCTAACATTCCTTACTCGAGTAAGGAATGTTAGAGCGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019861
VALIDATED
CTSF MISSION shRNA Lentiviral Transduction Particles
cathepsin F
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349999    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019861.1-1788s21c1
Sequence:CCGGCAAGAACCTGGCTACAGTATGCTCGAGCATACTGTAGCCAGGTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019861.1-686s21c1
Sequence:CCGGCAGTGGCGATTGACTGTCTTTCTCGAGAAAGACAGTCAATCGCCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019861.1-863s21c1
Sequence:CCGGGCCAAGTCCATAAATGATCTTCTCGAGAAGATCATTTATGGACTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019861.1-647s21c1
Sequence:CCGGACCACCTATAACCGGACTTATCTCGAGATAAGTCCGGTTATAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019861.1-280s21c1
Sequence:CCGGCGCGCTGGACATGTACAATTACTCGAGTAATTGTACATGTCCAGCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019861.1-863s1c1
Sequence:CCGGGCCAAGTCCATAAATGATCTTCTCGAGAAGATCATTTATGGACTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019861.1-280s1c1
Sequence:CCGGCGCGCTGGACATGTACAATTACTCGAGTAATTGTACATGTCCAGCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019861.1-686s1c1
Sequence:CCGGCAGTGGCGATTGACTGTCTTTCTCGAGAAAGACAGTCAATCGCCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019861.1-554s1c1
Sequence:CCGGGCGACTTTCAGCTCATTCCTTCTCGAGAAGGAATGAGCTGAAAGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019861.1-1390s1c1
Sequence:CCGGCAACCGCTCTAACATTCCTTACTCGAGTAAGGAATGTTAGAGCGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003793
VALIDATED
CTSF MISSION shRNA Bacterial Glycerol Stock
cathepsin F
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003793.3-627s21c1
Sequence:CCGGGCCTGTGAAGATGGCTTCAATCTCGAGATTGAAGCCATCTTCACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003793.3-711s21c1
Sequence:CCGGCCTGTCCGTCTTTGTCAATAACTCGAGTTATTGACAAAGACGGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003793.3-570s21c1
Sequence:CCGGCGAGACTTTCAGCTCAGTCATCTCGAGATGACTGAGCTGAAAGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003793.3-664s21c1
Sequence:CCGGATTACCTATAACCGGACATATCTCGAGATATGTCCGGTTATAGGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003793.2-627s1c1
Sequence:CCGGGCCTGTGAAGATGGCTTCAATCTCGAGATTGAAGCCATCTTCACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003793.2-859s1c1
Sequence:CCGGCCTGGCAACAAGATGAAGCAACTCGAGTTGCTTCATCTTGTTGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003793.2-1056s1c1
Sequence:CCGGGCTCTTGGACTGTGACAAGATCTCGAGATCTTGTCACAGTCCAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003793.2-711s1c1
Sequence:CCGGCCTGTCCGTCTTTGTCAATAACTCGAGTTATTGACAAAGACGGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003793.2-570s1c1
Sequence:CCGGCGAGACTTTCAGCTCAGTCATCTCGAGATGACTGAGCTGAAAGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003793
VALIDATED
CTSF MISSION shRNA shRNA Plasmid DNA
cathepsin F
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003793.3-627s21c1
Sequence:CCGGGCCTGTGAAGATGGCTTCAATCTCGAGATTGAAGCCATCTTCACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003793.3-711s21c1
Sequence:CCGGCCTGTCCGTCTTTGTCAATAACTCGAGTTATTGACAAAGACGGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003793.3-570s21c1
Sequence:CCGGCGAGACTTTCAGCTCAGTCATCTCGAGATGACTGAGCTGAAAGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003793.3-664s21c1
Sequence:CCGGATTACCTATAACCGGACATATCTCGAGATATGTCCGGTTATAGGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003793.2-627s1c1
Sequence:CCGGGCCTGTGAAGATGGCTTCAATCTCGAGATTGAAGCCATCTTCACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003793.2-859s1c1
Sequence:CCGGCCTGGCAACAAGATGAAGCAACTCGAGTTGCTTCATCTTGTTGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003793.2-1056s1c1
Sequence:CCGGGCTCTTGGACTGTGACAAGATCTCGAGATCTTGTCACAGTCCAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003793.2-711s1c1
Sequence:CCGGCCTGTCCGTCTTTGTCAATAACTCGAGTTATTGACAAAGACGGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003793.2-570s1c1
Sequence:CCGGCGAGACTTTCAGCTCAGTCATCTCGAGATGACTGAGCTGAAAGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003793
VALIDATED
CTSF MISSION shRNA Lentiviral Transduction Particles
cathepsin F
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003793.3-627s21c1
Sequence:CCGGGCCTGTGAAGATGGCTTCAATCTCGAGATTGAAGCCATCTTCACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003793.3-711s21c1
Sequence:CCGGCCTGTCCGTCTTTGTCAATAACTCGAGTTATTGACAAAGACGGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003793.3-570s21c1
Sequence:CCGGCGAGACTTTCAGCTCAGTCATCTCGAGATGACTGAGCTGAAAGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003793.3-664s21c1
Sequence:CCGGATTACCTATAACCGGACATATCTCGAGATATGTCCGGTTATAGGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003793.2-627s1c1
Sequence:CCGGGCCTGTGAAGATGGCTTCAATCTCGAGATTGAAGCCATCTTCACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003793.2-859s1c1
Sequence:CCGGCCTGGCAACAAGATGAAGCAACTCGAGTTGCTTCATCTTGTTGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003793.2-1056s1c1
Sequence:CCGGGCTCTTGGACTGTGACAAGATCTCGAGATCTTGTCACAGTCCAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003793.2-711s1c1
Sequence:CCGGCCTGTCCGTCTTTGTCAATAACTCGAGTTATTGACAAAGACGGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003793.2-570s1c1
Sequence:CCGGCGAGACTTTCAGCTCAGTCATCTCGAGATGACTGAGCTGAAAGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)