EMAIL THIS PAGE TO A FRIEND

CTSG

cathepsin G

57 Gene Product Result for
Synonyms: CATG CG
UniProtKB ID: P08311, Q6IBJ6, Q9UCA5, Q9UCU6
Gene ID:
Human(1511) Summary: The protein encoded by this gene, a member of the peptidase S1 protein family, is found in azurophil granules of neutrophilic polymorphonuclear leukocytes. The encoded protease has a specificity similar to that of chymotrypsin C, and may participate in the killing and digestion of engulfed pathogens, and in connective tissue remodeling at sites of inflammation. Transcript variants utilizing alternative polyadenylation signals exist for this gene. [provided by RefSeq, Jul 2008]
Mouse(13035) cathepsin G
Rat(290257) cathepsin G
chicken(426049) cathepsin G
cow(505658) cathepsin G
dog(608543) cathepsin G
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
65800 2-Methylanthraquinone technical, ≥95% (HPLC) human pricing

Small Molecule - Substrate

Product # Description Species Add to Cart
 
M7771 N-Methoxysuccinyl-Ala-Ala-Pro-Met p-nitroanilide >95% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007800 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007800 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007800 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001911 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001911 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001911 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU028931 MISSION® esiRNA esiRNA human CTSG (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001911 Rosetta Predictions human pricing
NM_001106041 Rosetta Predictions rat pricing
NM_007800 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013064 predicted 342
2 SASI_Hs01_00013065 predicted 521
3 SASI_Hs01_00013066 predicted 672
4 SASI_Hs01_00013067 predicted 384
5 SASI_Hs01_00013068 predicted 377
6 SASI_Hs01_00013069 predicted 436
7 SASI_Hs01_00013070 predicted 357
8 SASI_Hs01_00013071 predicted 339
9 SASI_Hs01_00013072 predicted 678
10 SASI_Hs01_00013073 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106041 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215042 predicted 434
2 SASI_Rn02_00215043 predicted 677
3 SASI_Rn02_00215044 predicted 233
4 SASI_Rn02_00215045 predicted 689
5 SASI_Rn02_00215046 predicted 408
6 SASI_Rn02_00215047 predicted 500
7 SASI_Rn02_00215048 predicted 199
8 SASI_Rn02_00215049 predicted 772
9 SASI_Rn02_00215050 predicted 436
10 SASI_Rn02_00215051 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007800 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170824 predicted 682
2 SASI_Mm02_00312494 predicted 235
3 SASI_Mm01_00170825 predicted 285
4 SASI_Mm01_00170826 predicted 687
5 SASI_Mm01_00170827 predicted 437
6 SASI_Mm01_00170828 predicted 330
7 SASI_Mm01_00170829 predicted 448
8 SASI_Mm01_00170830 predicted 341
9 SASI_Mm01_00170831 predicted 271
10 SASI_Mm01_00170832 predicted 393
11 SASI_Mm01_00170833 predicted 500
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007800
CTSG MISSION shRNA Bacterial Glycerol Stock
cathepsin G
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007800.1-367s1c1
Sequence:CCGGCACAACATCCAAATGCGAGAACTCGAGTTCTCGCATTTGGATGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007800.1-426s1c1
Sequence:CCGGCCATCCTGATTACAATCCGCACTCGAGTGCGGATTGTAATCAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007800.1-237s1c1
Sequence:CCGGCTACATGGCATTTCTTCTGATCTCGAGATCAGAAGAAATGCCATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007800.1-780s1c1
Sequence:CCGGCGTCTCCTATGGAAGCAACAACTCGAGTTGTTGCTTCCATAGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007800.1-831s1c1
Sequence:CCGGCCAGAGCTTCATGCCCTGGATCTCGAGATCCAGGGCATGAAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007800
CTSG MISSION shRNA shRNA Plasmid DNA
cathepsin G
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007800.1-367s1c1
Sequence:CCGGCACAACATCCAAATGCGAGAACTCGAGTTCTCGCATTTGGATGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007800.1-426s1c1
Sequence:CCGGCCATCCTGATTACAATCCGCACTCGAGTGCGGATTGTAATCAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007800.1-237s1c1
Sequence:CCGGCTACATGGCATTTCTTCTGATCTCGAGATCAGAAGAAATGCCATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007800.1-780s1c1
Sequence:CCGGCGTCTCCTATGGAAGCAACAACTCGAGTTGTTGCTTCCATAGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007800.1-831s1c1
Sequence:CCGGCCAGAGCTTCATGCCCTGGATCTCGAGATCCAGGGCATGAAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007800
CTSG MISSION shRNA Lentiviral Transduction Particles
cathepsin G
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007800.1-367s1c1
Sequence:CCGGCACAACATCCAAATGCGAGAACTCGAGTTCTCGCATTTGGATGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007800.1-426s1c1
Sequence:CCGGCCATCCTGATTACAATCCGCACTCGAGTGCGGATTGTAATCAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007800.1-237s1c1
Sequence:CCGGCTACATGGCATTTCTTCTGATCTCGAGATCAGAAGAAATGCCATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007800.1-780s1c1
Sequence:CCGGCGTCTCCTATGGAAGCAACAACTCGAGTTGTTGCTTCCATAGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007800.1-831s1c1
Sequence:CCGGCCAGAGCTTCATGCCCTGGATCTCGAGATCCAGGGCATGAAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001911
CTSG MISSION shRNA Bacterial Glycerol Stock
cathepsin G
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001911.x-317s1c1
Sequence:CCGGGCCATCCGCCACCCTCAATATCTCGAGATATTGAGGGTGGCGGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001911.x-331s1c1
Sequence:CCGGTCAATATAATCAGCGGACCATCTCGAGATGGTCCGCTGATTATATTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001911.x-395s1c1
Sequence:CCGGCGGAATCGAAACGTGAACCCACTCGAGTGGGTTCACGTTTCGATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001911.x-401s1c1
Sequence:CCGGCGAAACGTGAACCCAGTGGCTCTCGAGAGCCACTGGGTTCACGTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003671    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001911.x-843s1c1
Sequence:CCGGGTGTTGCCAGAGCCTTAATAACTCGAGTTATTAAGGCTCTGGCAACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001911.2-673s21c1
Sequence:CCGGCGGCATCGTCTCCTATGGAAACTCGAGTTTCCATAGGAGACGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001911.2-192s21c1
Sequence:CCGGTCCTGGTGCGAGAAGACTTTGCTCGAGCAAAGTCTTCTCGCACCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001911.2-353s21c1
Sequence:CCGGCAGAATGACATCATGTTATTGCTCGAGCAATAACATGATGTCATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001911
CTSG MISSION shRNA shRNA Plasmid DNA
cathepsin G
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001911.x-317s1c1
Sequence:CCGGGCCATCCGCCACCCTCAATATCTCGAGATATTGAGGGTGGCGGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001911.x-331s1c1
Sequence:CCGGTCAATATAATCAGCGGACCATCTCGAGATGGTCCGCTGATTATATTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001911.x-395s1c1
Sequence:CCGGCGGAATCGAAACGTGAACCCACTCGAGTGGGTTCACGTTTCGATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001911.x-401s1c1
Sequence:CCGGCGAAACGTGAACCCAGTGGCTCTCGAGAGCCACTGGGTTCACGTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003671    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001911.x-843s1c1
Sequence:CCGGGTGTTGCCAGAGCCTTAATAACTCGAGTTATTAAGGCTCTGGCAACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001911.2-673s21c1
Sequence:CCGGCGGCATCGTCTCCTATGGAAACTCGAGTTTCCATAGGAGACGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001911.2-192s21c1
Sequence:CCGGTCCTGGTGCGAGAAGACTTTGCTCGAGCAAAGTCTTCTCGCACCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001911.2-353s21c1
Sequence:CCGGCAGAATGACATCATGTTATTGCTCGAGCAATAACATGATGTCATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001911
CTSG MISSION shRNA Lentiviral Transduction Particles
cathepsin G
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001911.x-317s1c1
Sequence:CCGGGCCATCCGCCACCCTCAATATCTCGAGATATTGAGGGTGGCGGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001911.x-331s1c1
Sequence:CCGGTCAATATAATCAGCGGACCATCTCGAGATGGTCCGCTGATTATATTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001911.x-395s1c1
Sequence:CCGGCGGAATCGAAACGTGAACCCACTCGAGTGGGTTCACGTTTCGATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001911.x-401s1c1
Sequence:CCGGCGAAACGTGAACCCAGTGGCTCTCGAGAGCCACTGGGTTCACGTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003671    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001911.x-843s1c1
Sequence:CCGGGTGTTGCCAGAGCCTTAATAACTCGAGTTATTAAGGCTCTGGCAACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001911.2-673s21c1
Sequence:CCGGCGGCATCGTCTCCTATGGAAACTCGAGTTTCCATAGGAGACGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001911.2-192s21c1
Sequence:CCGGTCCTGGTGCGAGAAGACTTTGCTCGAGCAAAGTCTTCTCGCACCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001911.2-353s21c1
Sequence:CCGGCAGAATGACATCATGTTATTGCTCGAGCAATAACATGATGTCATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks