EMAIL THIS PAGE TO A FRIEND

CTSH

cathepsin H

Synonyms: ACC-4 ACC-5 CPSB minichain
UniProtKB ID: P09668, B2RBK0, Q96NY6, Q9BUM7
Gene ID:
Human(1512) Summary: The protein encoded by this gene is a lysosomal cysteine proteinase important in the overall degradation of lysosomal proteins. It is composed of a dimer of disulfide-linked heavy and light chains, both produced from a single protein precursor. The encoded protein, which belongs to the peptidase C1 protein family, can act both as an aminopeptidase and as an endopeptidase. Increased expression of this gene has been correlated with malignant progression of prostate tumors. [provided by RefSeq, Mar 2010]
Mouse(13036) cathepsin H
Rat(25425) cathepsin H
sheep(101108427) cathepsin H
Zebrafish(324818) cathepsin H
chicken(770109) cathepsin H
dog(479065) cathepsin H
cow(510524) cathepsin H
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007801 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007801 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007801 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004390 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004390 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004390 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU079011 MISSION® esiRNA esiRNA human CTSH (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004390 Rosetta Predictions human pricing
NM_148979 Rosetta Predictions human pricing
NM_012939 Rosetta Predictions rat pricing
NM_007801 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004390 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199484 predicted 943
2 SASI_Hs01_00199485 predicted 662
3 SASI_Hs01_00199486 predicted 844
4 SASI_Hs01_00199487 predicted 859
5 SASI_Hs01_00199488 predicted 888
6 SASI_Hs01_00199491 predicted 657
7 SASI_Hs01_00199493 predicted 1015
8 SASI_Hs02_00337499 predicted 851
9 SASI_Hs02_00337500 predicted 448
10 SASI_Hs01_00199489 predicted 388
11 SASI_Hs01_00199490 predicted 751
12 SASI_Hs01_00199492 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148979 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180677 predicted 913
2 SASI_Hs01_00180678 predicted 618
3 SASI_Hs01_00180679 predicted 807
4 SASI_Hs01_00180680 predicted 822
5 SASI_Hs01_00180681 predicted 852
6 SASI_Hs01_00180684 predicted 621
7 SASI_Hs01_00180686 predicted 979
8 SASI_Hs02_00365695 predicted 822
9 SASI_Hs02_00365696 predicted 404
10 SASI_Hs01_00180682 predicted 356
11 SASI_Hs01_00180683 predicted 710
12 SASI_Hs01_00180685 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012939 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054676 predicted 620
2 SASI_Rn01_00054677 predicted 452
3 SASI_Rn01_00054678 predicted 619
4 SASI_Rn01_00054679 predicted 564
5 SASI_Rn01_00054680 predicted 857
6 SASI_Rn01_00054681 predicted 1117
7 SASI_Rn01_00054682 predicted 1116
8 SASI_Rn01_00054683 predicted 1126
9 SASI_Rn01_00054684 predicted 238
10 SASI_Rn01_00054685 predicted 991
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007801 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088491 predicted 845
2 SASI_Mm01_00088492 predicted 1201
3 SASI_Mm02_00312495 predicted 516
4 SASI_Mm01_00088493 predicted 895
5 SASI_Mm02_00312496 predicted 1134
6 SASI_Mm02_00312497 predicted 576
7 SASI_Mm02_00312498 predicted 1073
8 SASI_Mm02_00312499 predicted 729
9 SASI_Mm01_00088494 predicted 1294
10 SASI_Mm01_00088495 predicted 891
11 SASI_Mm01_00088496 predicted 669
12 SASI_Mm01_00088497 predicted 978
13 SASI_Mm01_00088498 predicted 624
14 SASI_Mm01_00088499 predicted 743
15 SASI_Mm01_00088500 predicted 421
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007801
VALIDATED
CTSH MISSION shRNA Bacterial Glycerol Stock
cathepsin H
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007801.2-484s21c1
Sequence:CCGGCCAGAGGAACCACACATTTAACTCGAGTTAAATGTGTGGTTCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007801.2-903s21c1
Sequence:CCGGGCAAGGATAGTTCATGCAGATCTCGAGATCTGCATGAACTATCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007801.2-1263s21c1
Sequence:CCGGCCTATCCCATTCCTCAGGTATCTCGAGATACCTGAGGAATGGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007801.2-938s21c1
Sequence:CCGGGCTGTTGCATTCGTCAAGAATCTCGAGATTCTTGACGAATGCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007801.2-794s21c1
Sequence:CCGGGCCCAAGCCTTCAACAATCATCTCGAGATGATTGTTGAAGGCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007801.1-702s1c1
Sequence:CCGGGCTGTTGCATTCGTCAAGAATCTCGAGATTCTTGACGAATGCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007801.1-558s1c1
Sequence:CCGGGCCCAAGCCTTCAACAATCATCTCGAGATGATTGTTGAAGGCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007801.1-248s1c1
Sequence:CCGGCCAGAGGAACCACACATTTAACTCGAGTTAAATGTGTGGTTCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007801.1-667s1c1
Sequence:CCGGGCAAGGATAGTTCATGCAGATCTCGAGATCTGCATGAACTATCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007801.1-1027s1c1
Sequence:CCGGCCTATCCCATTCCTCAGGTATCTCGAGATACCTGAGGAATGGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007801
VALIDATED
CTSH MISSION shRNA shRNA Plasmid DNA
cathepsin H
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007801.2-484s21c1
Sequence:CCGGCCAGAGGAACCACACATTTAACTCGAGTTAAATGTGTGGTTCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007801.2-903s21c1
Sequence:CCGGGCAAGGATAGTTCATGCAGATCTCGAGATCTGCATGAACTATCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007801.2-1263s21c1
Sequence:CCGGCCTATCCCATTCCTCAGGTATCTCGAGATACCTGAGGAATGGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007801.2-938s21c1
Sequence:CCGGGCTGTTGCATTCGTCAAGAATCTCGAGATTCTTGACGAATGCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007801.2-794s21c1
Sequence:CCGGGCCCAAGCCTTCAACAATCATCTCGAGATGATTGTTGAAGGCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007801.1-702s1c1
Sequence:CCGGGCTGTTGCATTCGTCAAGAATCTCGAGATTCTTGACGAATGCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007801.1-558s1c1
Sequence:CCGGGCCCAAGCCTTCAACAATCATCTCGAGATGATTGTTGAAGGCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007801.1-248s1c1
Sequence:CCGGCCAGAGGAACCACACATTTAACTCGAGTTAAATGTGTGGTTCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007801.1-667s1c1
Sequence:CCGGGCAAGGATAGTTCATGCAGATCTCGAGATCTGCATGAACTATCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007801.1-1027s1c1
Sequence:CCGGCCTATCCCATTCCTCAGGTATCTCGAGATACCTGAGGAATGGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007801
VALIDATED
CTSH MISSION shRNA Lentiviral Transduction Particles
cathepsin H
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007801.2-484s21c1
Sequence:CCGGCCAGAGGAACCACACATTTAACTCGAGTTAAATGTGTGGTTCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007801.2-903s21c1
Sequence:CCGGGCAAGGATAGTTCATGCAGATCTCGAGATCTGCATGAACTATCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007801.2-1263s21c1
Sequence:CCGGCCTATCCCATTCCTCAGGTATCTCGAGATACCTGAGGAATGGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007801.2-938s21c1
Sequence:CCGGGCTGTTGCATTCGTCAAGAATCTCGAGATTCTTGACGAATGCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007801.2-794s21c1
Sequence:CCGGGCCCAAGCCTTCAACAATCATCTCGAGATGATTGTTGAAGGCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007801.1-702s1c1
Sequence:CCGGGCTGTTGCATTCGTCAAGAATCTCGAGATTCTTGACGAATGCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007801.1-558s1c1
Sequence:CCGGGCCCAAGCCTTCAACAATCATCTCGAGATGATTGTTGAAGGCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007801.1-248s1c1
Sequence:CCGGCCAGAGGAACCACACATTTAACTCGAGTTAAATGTGTGGTTCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007801.1-667s1c1
Sequence:CCGGGCAAGGATAGTTCATGCAGATCTCGAGATCTGCATGAACTATCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007801.1-1027s1c1
Sequence:CCGGCCTATCCCATTCCTCAGGTATCTCGAGATACCTGAGGAATGGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004390
VALIDATED
CTSH MISSION shRNA Bacterial Glycerol Stock
cathepsin H
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004390.3-1297s21c1
Sequence:CCGGGACGCAAAGATCACCAGCCATCTCGAGATGGCTGGTGATCTTTGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004390.3-283s21c1
Sequence:CCGGGAGGAAGATAAACGCCCACAACTCGAGTTGTGGGCGTTTATCTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004390.3-926s21c1
Sequence:CCGGGATAAAGTAAACCATGCAGTACTCGAGTACTGCATGGTTTACTTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004390.3-208s21c1
Sequence:CCGGATGGATGTCTAAGCACCGTAACTCGAGTTACGGTGCTTAGACATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004390.x-206s1c1
Sequence:CCGGATGGATGTCTAAGCACCGTAACTCGAGTTACGGTGCTTAGACATCCATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003699    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004390.x-1295s1c1
Sequence:CCGGGACGCAAAGATCACCAGCCATCTCGAGATGGCTGGTGATCTTTGCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004390.x-281s1c1
Sequence:CCGGGAGGAAGATAAACGCCCACAACTCGAGTTGTGGGCGTTTATCTTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004390.x-924s1c1
Sequence:CCGGGATAAAGTAAACCATGCAGTACTCGAGTACTGCATGGTTTACTTTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004390
VALIDATED
CTSH MISSION shRNA shRNA Plasmid DNA
cathepsin H
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004390.3-1297s21c1
Sequence:CCGGGACGCAAAGATCACCAGCCATCTCGAGATGGCTGGTGATCTTTGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004390.3-283s21c1
Sequence:CCGGGAGGAAGATAAACGCCCACAACTCGAGTTGTGGGCGTTTATCTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004390.3-926s21c1
Sequence:CCGGGATAAAGTAAACCATGCAGTACTCGAGTACTGCATGGTTTACTTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004390.3-208s21c1
Sequence:CCGGATGGATGTCTAAGCACCGTAACTCGAGTTACGGTGCTTAGACATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004390.x-206s1c1
Sequence:CCGGATGGATGTCTAAGCACCGTAACTCGAGTTACGGTGCTTAGACATCCATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003699    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004390.x-1295s1c1
Sequence:CCGGGACGCAAAGATCACCAGCCATCTCGAGATGGCTGGTGATCTTTGCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004390.x-281s1c1
Sequence:CCGGGAGGAAGATAAACGCCCACAACTCGAGTTGTGGGCGTTTATCTTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004390.x-924s1c1
Sequence:CCGGGATAAAGTAAACCATGCAGTACTCGAGTACTGCATGGTTTACTTTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004390
VALIDATED
CTSH MISSION shRNA Lentiviral Transduction Particles
cathepsin H
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004390.3-1297s21c1
Sequence:CCGGGACGCAAAGATCACCAGCCATCTCGAGATGGCTGGTGATCTTTGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004390.3-283s21c1
Sequence:CCGGGAGGAAGATAAACGCCCACAACTCGAGTTGTGGGCGTTTATCTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004390.3-926s21c1
Sequence:CCGGGATAAAGTAAACCATGCAGTACTCGAGTACTGCATGGTTTACTTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004390.3-208s21c1
Sequence:CCGGATGGATGTCTAAGCACCGTAACTCGAGTTACGGTGCTTAGACATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004390.x-206s1c1
Sequence:CCGGATGGATGTCTAAGCACCGTAACTCGAGTTACGGTGCTTAGACATCCATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003699    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004390.x-1295s1c1
Sequence:CCGGGACGCAAAGATCACCAGCCATCTCGAGATGGCTGGTGATCTTTGCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004390.x-281s1c1
Sequence:CCGGGAGGAAGATAAACGCCCACAACTCGAGTTGTGGGCGTTTATCTTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004390.x-924s1c1
Sequence:CCGGGATAAAGTAAACCATGCAGTACTCGAGTACTGCATGGTTTACTTTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks