EMAIL THIS PAGE TO A FRIEND

CTSK

cathepsin K

97 Gene Product Result for
Synonyms: CTS02 CTSO CTSO1 CTSO2 PKND PYCD
UniProtKB ID: P43235, Q6FHS6
Gene ID:
Human(1513) Summary: The protein encoded by this gene is a lysosomal cysteine proteinase involved in bone remodeling and resorption. This protein, which is a member of the peptidase C1 protein family, is predominantly expressed in osteoclasts. However, the encoded protein is also expressed in a significant fraction of human breast cancers, where it could contribute to tumor invasiveness. Mutations in this gene are the cause of pycnodysostosis, an autosomal recessive disease characterized by osteosclerosis and short stature. [provided by RefSeq, Apr 2013]
Mouse(13038) cathepsin K
Rat(29175) cathepsin K
sheep(101108972) cathepsin K
Zebrafish(550475) cathepsin K
chicken(395818) cathepsin K
cow(513038) cathepsin K
dog(608843) cathepsin K
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Activity Assay

Product # Description Species Add to Cart
 
CS1150 SensiZyme Cathepsin K Activity Assay Kit sufficient for 100 reactions human pricing

Kits

Product # Description Species Add to Cart
 
MAK201 Cathepsin K Inhibitor Screening Kit Sufficient for 100 Fluorometric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007802 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007802 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007802 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000396 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000396 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000396 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000396 Rosetta Predictions human pricing
NM_031560 Rosetta Predictions rat pricing
NM_007802 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000396 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021520 predicted 408
2 SASI_Hs01_00021521 predicted 242
3 SASI_Hs01_00021523 predicted 279
4 SASI_Hs01_00021524 predicted 493
5 SASI_Hs01_00021525 predicted 979
6 SASI_Hs01_00021526 predicted 620
7 SASI_Hs01_00021527 predicted 492
8 SASI_Hs01_00021528 predicted 240
9 SASI_Hs01_00021529 predicted 246
10 SASI_Hs02_00302470 predicted 331
11 SASI_Hs01_00021522 predicted 985
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031560 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091161 predicted 262
2 SASI_Rn01_00091162 predicted 825
3 SASI_Rn02_00264777 predicted 843
4 SASI_Rn01_00091163 predicted 717
5 SASI_Rn01_00091164 predicted 987
6 SASI_Rn01_00091165 predicted 935
7 SASI_Rn01_00091166 predicted 534
8 SASI_Rn01_00091167 predicted 879
9 SASI_Rn01_00091168 predicted 912
10 SASI_Rn01_00091169 predicted 821
11 SASI_Rn01_00091170 predicted 724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007802 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312500 predicted 240
2 SASI_Mm01_00138391 predicted 872
3 SASI_Mm01_00138392 predicted 264
4 SASI_Mm01_00138393 predicted 417
5 SASI_Mm01_00138394 predicted 1084
6 SASI_Mm01_00138395 predicted 512
7 SASI_Mm02_00312501 predicted 971
8 SASI_Mm01_00138397 predicted 656
9 SASI_Mm01_00138398 predicted 408
10 SASI_Mm02_00312502 predicted 1092
11 SASI_Mm01_00138389 predicted 669
12 SASI_Mm01_00138390 predicted 304
13 SASI_Mm01_00138396 predicted 918
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007802
VALIDATED
CTSK MISSION shRNA Bacterial Glycerol Stock
cathepsin K
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007802.2-189s1c1
Sequence:CCGGCGGCGTTTAATTTGGGAGAAACTCGAGTTTCTCCCAAATTAAACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007802.2-861s1c1
Sequence:CCGGGACCGTGATAATGTGAACCATCTCGAGATGGTTCACATTATCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007802.2-410s1c1
Sequence:CCGGCGACTATCGAAAGAAAGGATACTCGAGTATCCTTTCTTTCGATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007802.2-668s1c1
Sequence:CCGGCCAGGATGAAAGTTGTATGTACTCGAGTACATACAACTTTCATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007802.2-244s1c1
Sequence:CCGGCCTCTCTTGGTGTCCATACATCTCGAGATGTATGGACACCAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007802.2-342s1c1
Sequence:CCGGCCCTCTCGATCCTACAGTAATCTCGAGATTACTGTAGGATCGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007802.2-590s1c1
Sequence:CCGGCGGCTATATGACCACTGCCTTCTCGAGAAGGCAGTGGTCATATAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007802.2-498s1c1
Sequence:CCGGGAGGGCCAACTCAAGAAGAAACTCGAGTTTCTTCTTGAGTTGGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329270    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007802.3-1139s21c1
Sequence:CCGGGACGCAGCGATGCTAACTAAGCTCGAGCTTAGTTAGCATCGCTGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007802.3-973s21c1
Sequence:CCGGTGCTCTCTTGGCTCGGAATAACTCGAGTTATTCCGAGCCAAGAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007802.3-694s21c1
Sequence:CCGGCACGGCAAAGGCAGCTAAATGCTCGAGCATTTAGCTGCCTTTGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007802.3-917s21c1
Sequence:CCGGAGCAAGCACTGGATAATTAAACTCGAGTTTAATTATCCAGTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007802.3-178s21c1
Sequence:CCGGTGAAATCTCTCGGCGTTTAATCTCGAGATTAAACGCCGAGAGATTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007802
VALIDATED
CTSK MISSION shRNA shRNA Plasmid DNA
cathepsin K
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007802.2-189s1c1
Sequence:CCGGCGGCGTTTAATTTGGGAGAAACTCGAGTTTCTCCCAAATTAAACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007802.2-861s1c1
Sequence:CCGGGACCGTGATAATGTGAACCATCTCGAGATGGTTCACATTATCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007802.2-410s1c1
Sequence:CCGGCGACTATCGAAAGAAAGGATACTCGAGTATCCTTTCTTTCGATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007802.2-668s1c1
Sequence:CCGGCCAGGATGAAAGTTGTATGTACTCGAGTACATACAACTTTCATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007802.2-244s1c1
Sequence:CCGGCCTCTCTTGGTGTCCATACATCTCGAGATGTATGGACACCAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007802.2-342s1c1
Sequence:CCGGCCCTCTCGATCCTACAGTAATCTCGAGATTACTGTAGGATCGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007802.2-590s1c1
Sequence:CCGGCGGCTATATGACCACTGCCTTCTCGAGAAGGCAGTGGTCATATAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007802.2-498s1c1
Sequence:CCGGGAGGGCCAACTCAAGAAGAAACTCGAGTTTCTTCTTGAGTTGGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329270    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007802.3-1139s21c1
Sequence:CCGGGACGCAGCGATGCTAACTAAGCTCGAGCTTAGTTAGCATCGCTGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007802.3-973s21c1
Sequence:CCGGTGCTCTCTTGGCTCGGAATAACTCGAGTTATTCCGAGCCAAGAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007802.3-694s21c1
Sequence:CCGGCACGGCAAAGGCAGCTAAATGCTCGAGCATTTAGCTGCCTTTGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007802.3-917s21c1
Sequence:CCGGAGCAAGCACTGGATAATTAAACTCGAGTTTAATTATCCAGTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007802.3-178s21c1
Sequence:CCGGTGAAATCTCTCGGCGTTTAATCTCGAGATTAAACGCCGAGAGATTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007802
VALIDATED
CTSK MISSION shRNA Lentiviral Transduction Particles
cathepsin K
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007802.2-189s1c1
Sequence:CCGGCGGCGTTTAATTTGGGAGAAACTCGAGTTTCTCCCAAATTAAACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007802.2-861s1c1
Sequence:CCGGGACCGTGATAATGTGAACCATCTCGAGATGGTTCACATTATCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007802.2-410s1c1
Sequence:CCGGCGACTATCGAAAGAAAGGATACTCGAGTATCCTTTCTTTCGATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007802.2-668s1c1
Sequence:CCGGCCAGGATGAAAGTTGTATGTACTCGAGTACATACAACTTTCATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007802.2-244s1c1
Sequence:CCGGCCTCTCTTGGTGTCCATACATCTCGAGATGTATGGACACCAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007802.2-342s1c1
Sequence:CCGGCCCTCTCGATCCTACAGTAATCTCGAGATTACTGTAGGATCGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007802.2-590s1c1
Sequence:CCGGCGGCTATATGACCACTGCCTTCTCGAGAAGGCAGTGGTCATATAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007802.2-498s1c1
Sequence:CCGGGAGGGCCAACTCAAGAAGAAACTCGAGTTTCTTCTTGAGTTGGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329270    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007802.3-1139s21c1
Sequence:CCGGGACGCAGCGATGCTAACTAAGCTCGAGCTTAGTTAGCATCGCTGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007802.3-973s21c1
Sequence:CCGGTGCTCTCTTGGCTCGGAATAACTCGAGTTATTCCGAGCCAAGAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007802.3-694s21c1
Sequence:CCGGCACGGCAAAGGCAGCTAAATGCTCGAGCATTTAGCTGCCTTTGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007802.3-917s21c1
Sequence:CCGGAGCAAGCACTGGATAATTAAACTCGAGTTTAATTATCCAGTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007802.3-178s21c1
Sequence:CCGGTGAAATCTCTCGGCGTTTAATCTCGAGATTAAACGCCGAGAGATTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000396
CTSK MISSION shRNA Bacterial Glycerol Stock
cathepsin K
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000396.x-229s1c1
Sequence:CCGGGCAATATAACAACAAGGTGGACTCGAGTCCACCTTGTTGTTATATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000396.x-1516s1c1
Sequence:CCGGAGTTCCCTTCTATATCCTCAACTCGAGTTGAGGATATAGAAGGGAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000396.x-435s1c1
Sequence:CCGGACACCCTTTATATCCCAGAATCTCGAGATTCTGGGATATAAAGGGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000396.x-423s1c1
Sequence:CCGGCCCGCAGTAATGACACCCTTTCTCGAGAAAGGGTGTCATTACTGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000396.x-1051s1c1
Sequence:CCGGCATGGCTCGAAATAAGAACAACTCGAGTTGTTCTTATTTCGAGCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000396.2-251s21c1
Sequence:CCGGGAAATCTCTCGGCGTTTAATTCTCGAGAATTAAACGCCGAGAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000396.2-922s21c1
Sequence:CCGGTGAAAGCTGCAATAGCGATAACTCGAGTTATCGCTATTGCAGCTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000396.2-668s21c1
Sequence:CCGGATGACCAATGCCTTCCAATATCTCGAGATATTGGAAGGCATTGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000396.2-1152s21c1
Sequence:CCGGTCCACGATGGTGCAGTGTAACCTCGAGGTTACACTGCACCATCGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000396
CTSK MISSION shRNA shRNA Plasmid DNA
cathepsin K
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000396.x-229s1c1
Sequence:CCGGGCAATATAACAACAAGGTGGACTCGAGTCCACCTTGTTGTTATATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000396.x-1516s1c1
Sequence:CCGGAGTTCCCTTCTATATCCTCAACTCGAGTTGAGGATATAGAAGGGAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000396.x-435s1c1
Sequence:CCGGACACCCTTTATATCCCAGAATCTCGAGATTCTGGGATATAAAGGGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000396.x-423s1c1
Sequence:CCGGCCCGCAGTAATGACACCCTTTCTCGAGAAAGGGTGTCATTACTGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000396.x-1051s1c1
Sequence:CCGGCATGGCTCGAAATAAGAACAACTCGAGTTGTTCTTATTTCGAGCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000396.2-251s21c1
Sequence:CCGGGAAATCTCTCGGCGTTTAATTCTCGAGAATTAAACGCCGAGAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000396.2-922s21c1
Sequence:CCGGTGAAAGCTGCAATAGCGATAACTCGAGTTATCGCTATTGCAGCTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000396.2-668s21c1
Sequence:CCGGATGACCAATGCCTTCCAATATCTCGAGATATTGGAAGGCATTGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000396.2-1152s21c1
Sequence:CCGGTCCACGATGGTGCAGTGTAACCTCGAGGTTACACTGCACCATCGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000396
CTSK MISSION shRNA Lentiviral Transduction Particles
cathepsin K
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000396.x-229s1c1
Sequence:CCGGGCAATATAACAACAAGGTGGACTCGAGTCCACCTTGTTGTTATATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000396.x-1516s1c1
Sequence:CCGGAGTTCCCTTCTATATCCTCAACTCGAGTTGAGGATATAGAAGGGAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000396.x-435s1c1
Sequence:CCGGACACCCTTTATATCCCAGAATCTCGAGATTCTGGGATATAAAGGGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000396.x-423s1c1
Sequence:CCGGCCCGCAGTAATGACACCCTTTCTCGAGAAAGGGTGTCATTACTGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000396.x-1051s1c1
Sequence:CCGGCATGGCTCGAAATAAGAACAACTCGAGTTGTTCTTATTTCGAGCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000396.2-251s21c1
Sequence:CCGGGAAATCTCTCGGCGTTTAATTCTCGAGAATTAAACGCCGAGAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000396.2-922s21c1
Sequence:CCGGTGAAAGCTGCAATAGCGATAACTCGAGTTATCGCTATTGCAGCTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000396.2-668s21c1
Sequence:CCGGATGACCAATGCCTTCCAATATCTCGAGATATTGGAAGGCATTGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000396.2-1152s21c1
Sequence:CCGGTCCACGATGGTGCAGTGTAACCTCGAGGTTACACTGCACCATCGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks