EMAIL THIS PAGE TO A FRIEND

CTSL3P

cathepsin L family member 3, pseudogene

18 Gene Product Result for
Synonyms: CTSL3 HCTSL-s
Species: Human CTSL3P(392360)
UniProtKB ID: Q5NE16
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001023564 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001023564 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001023564 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU117871 MISSION® esiRNA esiRNA human CTSL3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001023564 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001023564 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165956 predicted 527
2 SASI_Hs01_00165957 predicted 581
3 SASI_Hs01_00165958 predicted 240
4 SASI_Hs01_00165960 predicted 233
5 SASI_Hs01_00165961 predicted 306
6 SASI_Hs02_00307085 predicted 530
7 SASI_Hs02_00307086 predicted 267
8 SASI_Hs02_00307087 predicted 264
9 SASI_Hs01_00165953 predicted 206
10 SASI_Hs01_00165954 predicted 208
11 SASI_Hs01_00165955 predicted 207
12 SASI_Hs01_00165959 predicted 82
13 SASI_Hs01_00165962 predicted 69
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001023564
CTSL3P MISSION shRNA Bacterial Glycerol Stock
cathepsin L family member 3, pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023564.1-321s1c1
Sequence:CCGGCAAGGCAATGTTGGCTGCATTCTCGAGAATGCAGCCAACATTGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023564.1-312s1c1
Sequence:CCGGTCTAGGCTTCAAGGCAATGTTCTCGAGAACATTGCCTTGAAGCCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023564.1-172s1c1
Sequence:CCGGGACATCCGCAAATCTGTGGATCTCGAGATCCACAGATTTGCGGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023564.1-163s1c1
Sequence:CCGGCTGCTTCATGACATCCGCAAACTCGAGTTTGCGGATGTCATGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023564.1-247s1c1
Sequence:CCGGGTAAGGACAGATGTTAGGAAACTCGAGTTTCCTAACATCTGTCCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001023564
CTSL3P MISSION shRNA shRNA Plasmid DNA
cathepsin L family member 3, pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023564.1-321s1c1
Sequence:CCGGCAAGGCAATGTTGGCTGCATTCTCGAGAATGCAGCCAACATTGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023564.1-312s1c1
Sequence:CCGGTCTAGGCTTCAAGGCAATGTTCTCGAGAACATTGCCTTGAAGCCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023564.1-172s1c1
Sequence:CCGGGACATCCGCAAATCTGTGGATCTCGAGATCCACAGATTTGCGGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023564.1-163s1c1
Sequence:CCGGCTGCTTCATGACATCCGCAAACTCGAGTTTGCGGATGTCATGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023564.1-247s1c1
Sequence:CCGGGTAAGGACAGATGTTAGGAAACTCGAGTTTCCTAACATCTGTCCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001023564
CTSL3P MISSION shRNA Lentiviral Transduction Particles
cathepsin L family member 3, pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023564.1-321s1c1
Sequence:CCGGCAAGGCAATGTTGGCTGCATTCTCGAGAATGCAGCCAACATTGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023564.1-312s1c1
Sequence:CCGGTCTAGGCTTCAAGGCAATGTTCTCGAGAACATTGCCTTGAAGCCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023564.1-172s1c1
Sequence:CCGGGACATCCGCAAATCTGTGGATCTCGAGATCCACAGATTTGCGGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023564.1-163s1c1
Sequence:CCGGCTGCTTCATGACATCCGCAAACTCGAGTTTGCGGATGTCATGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001023564.1-247s1c1
Sequence:CCGGGTAAGGACAGATGTTAGGAAACTCGAGTTTCCTAACATCTGTCCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks