EMAIL THIS PAGE TO A FRIEND

CTSL

cathepsin L

58 Gene Product Result for
Synonyms: CATL CTSL1 MEP
Species: Human CTSL(1514), Mouse Ctsl(13039)
Gene ID:
Human(1514) Summary: The protein encoded by this gene is a lysosomal cysteine proteinase that plays a major role in intracellular protein catabolism. Its substrates include collagen and elastin, as well as alpha-1 protease inhibitor, a major controlling element of neutrophil elastase activity. The encoded protein has been implicated in several pathologic processes, including myofibril necrosis in myopathies and in myocardial ischemia, and in the renal tubular response to proteinuria. This protein, which is a member of the peptidase C1 family, is a dimer composed of disulfide-linked heavy and light chains, both produced from a single protein precursor. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Apr 2012]
Mouse(13039) cathepsin L
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
213810 Diethylcyanamide 99% human pricing

ELISA

Product # Description Species Add to Cart
 
RAB0635 Human CTSL / Cathepsin L1 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001912 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001912 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001912 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009984 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009984 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009984 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU106791 MISSION® esiRNA esiRNA human CTSL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001912 Rosetta Predictions human pricing
NM_145918 Rosetta Predictions human pricing
NM_009984 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079399 predicted 1286
2 SASI_Hs01_00079400 predicted 968
3 SASI_Hs02_00332791 predicted 1094
4 SASI_Hs01_00079401 predicted 955
5 SASI_Hs01_00079402 predicted 1293
6 SASI_Hs01_00079405 predicted 815
7 SASI_Hs01_00079406 predicted 912
8 SASI_Hs01_00079407 predicted 1404
9 SASI_Hs01_00079408 predicted 1290
10 SASI_Hs02_00332792 predicted 990
11 SASI_Hs01_00079403 predicted 892
12 SASI_Hs01_00079404 predicted 1118
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172916 predicted 1141
2 SASI_Hs01_00172917 predicted 818
3 SASI_Hs02_00365452 predicted 953
4 SASI_Hs01_00172918 predicted 810
5 SASI_Hs01_00172919 predicted 1151
6 SASI_Hs01_00172922 predicted 667
7 SASI_Hs01_00172923 predicted 761
8 SASI_Hs01_00172924 predicted 1253
9 SASI_Hs01_00172925 predicted 1141
10 SASI_Hs02_00365453 predicted 846
11 SASI_Hs01_00172920 predicted 745
12 SASI_Hs01_00172921 predicted 967
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009984 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196057 predicted 1061
2 SASI_Mm01_00196058 predicted 777
3 SASI_Mm01_00196059 predicted 1122
4 SASI_Mm01_00196060 predicted 1074
5 SASI_Mm01_00196063 predicted 864
6 SASI_Mm01_00196064 predicted 491
7 SASI_Mm02_00317579 predicted 1183
8 SASI_Mm01_00196065 predicted 1160
9 SASI_Mm01_00196066 predicted 1110
10 SASI_Mm02_00317580 predicted 604
11 SASI_Mm01_00196061 predicted 1179
12 SASI_Mm01_00196062 predicted 1008
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001912
CTSL MISSION shRNA Bacterial Glycerol Stock
cathepsin L
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001912.4-1294s21c1
Sequence:CCGGCCAAAGACCGGAGAAACCATTCTCGAGAATGGTTTCTCCGGTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001912.4-448s21c1
Sequence:CCGGAGGCGATGCACAACAGATTATCTCGAGATAATCTGTTGTGCATCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001912.4-503s21c1
Sequence:CCGGGTGGGAGAAGAACATGAAGATCTCGAGATCTTCATGTTCTTCTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001912.4-392s21c1
Sequence:CCGGTGCCTCAGCTACTCTAACATTCTCGAGAATGTTAGAGTAGCTGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001912.x-382s1c1
Sequence:CCGGGAATTGCCTCAGCTACTCTAACTCGAGTTAGAGTAGCTGAGGCAATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001912.x-497s1c1
Sequence:CCGGGTGGGAGAAGAACATGAAGATCTCGAGATCTTCATGTTCTTCTCCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001912.x-386s1c1
Sequence:CCGGTGCCTCAGCTACTCTAACATTCTCGAGAATGTTAGAGTAGCTGAGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001912.x-442s1c1
Sequence:CCGGAGGCGATGCACAACAGATTATCTCGAGATAATCTGTTGTGCATCGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001912
CTSL MISSION shRNA shRNA Plasmid DNA
cathepsin L
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001912.4-1294s21c1
Sequence:CCGGCCAAAGACCGGAGAAACCATTCTCGAGAATGGTTTCTCCGGTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001912.4-448s21c1
Sequence:CCGGAGGCGATGCACAACAGATTATCTCGAGATAATCTGTTGTGCATCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001912.4-503s21c1
Sequence:CCGGGTGGGAGAAGAACATGAAGATCTCGAGATCTTCATGTTCTTCTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001912.4-392s21c1
Sequence:CCGGTGCCTCAGCTACTCTAACATTCTCGAGAATGTTAGAGTAGCTGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001912.x-382s1c1
Sequence:CCGGGAATTGCCTCAGCTACTCTAACTCGAGTTAGAGTAGCTGAGGCAATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001912.x-497s1c1
Sequence:CCGGGTGGGAGAAGAACATGAAGATCTCGAGATCTTCATGTTCTTCTCCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001912.x-386s1c1
Sequence:CCGGTGCCTCAGCTACTCTAACATTCTCGAGAATGTTAGAGTAGCTGAGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001912.x-442s1c1
Sequence:CCGGAGGCGATGCACAACAGATTATCTCGAGATAATCTGTTGTGCATCGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001912
CTSL MISSION shRNA Lentiviral Transduction Particles
cathepsin L
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001912.4-1294s21c1
Sequence:CCGGCCAAAGACCGGAGAAACCATTCTCGAGAATGGTTTCTCCGGTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001912.4-448s21c1
Sequence:CCGGAGGCGATGCACAACAGATTATCTCGAGATAATCTGTTGTGCATCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001912.4-503s21c1
Sequence:CCGGGTGGGAGAAGAACATGAAGATCTCGAGATCTTCATGTTCTTCTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001912.4-392s21c1
Sequence:CCGGTGCCTCAGCTACTCTAACATTCTCGAGAATGTTAGAGTAGCTGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001912.x-382s1c1
Sequence:CCGGGAATTGCCTCAGCTACTCTAACTCGAGTTAGAGTAGCTGAGGCAATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001912.x-497s1c1
Sequence:CCGGGTGGGAGAAGAACATGAAGATCTCGAGATCTTCATGTTCTTCTCCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001912.x-386s1c1
Sequence:CCGGTGCCTCAGCTACTCTAACATTCTCGAGAATGTTAGAGTAGCTGAGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001912.x-442s1c1
Sequence:CCGGAGGCGATGCACAACAGATTATCTCGAGATAATCTGTTGTGCATCGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009984
VALIDATED
CTSL MISSION shRNA Bacterial Glycerol Stock
cathepsin L
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009984.3-638s21c1
Sequence:CCGGGCTTTCCAGTACATTAAGGAACTCGAGTTCCTTAATGTACTGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009984.3-1065s21c1
Sequence:CCGGCCAGCTATCCTGTCGTGAATTCTCGAGAATTCACGACAGGATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009984.3-190s21c1
Sequence:CCGGCAGAAGACTGTATGGCACGAACTCGAGTTCGTGCCATACAGTCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009984.3-523s21c1
Sequence:CCGGAGAAGGACAGATGTTCCTTAACTCGAGTTAAGGAACATCTGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009984.2-1066s1c1
Sequence:CCGGCCAGCTATCCTGTCGTGAATTCTCGAGAATTCACGACAGGATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009984.2-639s1c1
Sequence:CCGGGCTTTCCAGTACATTAAGGAACTCGAGTTCCTTAATGTACTGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009984.2-191s1c1
Sequence:CCGGCAGAAGACTGTATGGCACGAACTCGAGTTCGTGCCATACAGTCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009984.2-524s1c1
Sequence:CCGGAGAAGGACAGATGTTCCTTAACTCGAGTTAAGGAACATCTGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009984.2-851s1c1
Sequence:CCGGCCAGTTCTATAGTTCAGGCATCTCGAGATGCCTGAACTATAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009984
VALIDATED
CTSL MISSION shRNA shRNA Plasmid DNA
cathepsin L
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009984.3-638s21c1
Sequence:CCGGGCTTTCCAGTACATTAAGGAACTCGAGTTCCTTAATGTACTGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009984.3-1065s21c1
Sequence:CCGGCCAGCTATCCTGTCGTGAATTCTCGAGAATTCACGACAGGATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009984.3-190s21c1
Sequence:CCGGCAGAAGACTGTATGGCACGAACTCGAGTTCGTGCCATACAGTCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009984.3-523s21c1
Sequence:CCGGAGAAGGACAGATGTTCCTTAACTCGAGTTAAGGAACATCTGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009984.2-1066s1c1
Sequence:CCGGCCAGCTATCCTGTCGTGAATTCTCGAGAATTCACGACAGGATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009984.2-639s1c1
Sequence:CCGGGCTTTCCAGTACATTAAGGAACTCGAGTTCCTTAATGTACTGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009984.2-191s1c1
Sequence:CCGGCAGAAGACTGTATGGCACGAACTCGAGTTCGTGCCATACAGTCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009984.2-524s1c1
Sequence:CCGGAGAAGGACAGATGTTCCTTAACTCGAGTTAAGGAACATCTGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009984.2-851s1c1
Sequence:CCGGCCAGTTCTATAGTTCAGGCATCTCGAGATGCCTGAACTATAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009984
VALIDATED
CTSL MISSION shRNA Lentiviral Transduction Particles
cathepsin L
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009984.3-638s21c1
Sequence:CCGGGCTTTCCAGTACATTAAGGAACTCGAGTTCCTTAATGTACTGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009984.3-1065s21c1
Sequence:CCGGCCAGCTATCCTGTCGTGAATTCTCGAGAATTCACGACAGGATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009984.3-190s21c1
Sequence:CCGGCAGAAGACTGTATGGCACGAACTCGAGTTCGTGCCATACAGTCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009984.3-523s21c1
Sequence:CCGGAGAAGGACAGATGTTCCTTAACTCGAGTTAAGGAACATCTGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009984.2-1066s1c1
Sequence:CCGGCCAGCTATCCTGTCGTGAATTCTCGAGAATTCACGACAGGATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009984.2-639s1c1
Sequence:CCGGGCTTTCCAGTACATTAAGGAACTCGAGTTCCTTAATGTACTGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009984.2-191s1c1
Sequence:CCGGCAGAAGACTGTATGGCACGAACTCGAGTTCGTGCCATACAGTCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009984.2-524s1c1
Sequence:CCGGAGAAGGACAGATGTTCCTTAACTCGAGTTAAGGAACATCTGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009984.2-851s1c1
Sequence:CCGGCCAGTTCTATAGTTCAGGCATCTCGAGATGCCTGAACTATAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks