EMAIL THIS PAGE TO A FRIEND

CTSO

cathepsin O

39 Gene Product Result for
Synonyms: CTSO1
UniProtKB ID: P43234
Gene ID:
Human(1519) Summary: The protein encoded by the gene is a cysteine proteinase and a member of the papain superfamily. This proteolytic enzyme is involved in cellular protein degradation and turnover. The recombinant form of this enzyme was shown to degrade synthetic peptides typically used as substrates for cysteine proteinases and its proteolytic activity was abolished by an inhibitor of cyteine proteinase. [provided by RefSeq, Jul 2008]
Mouse(229445) cathepsin O
sheep(101112852) cathepsin O
Zebrafish(567333) cathepsin O
cow(616804) cathepsin O
dog(482665) cathepsin O
chicken(422410) cathepsin O
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177662 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177662 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177662 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001334 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001334 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001334 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001334 Rosetta Predictions human pricing
NM_177662 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001334 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044974 predicted 896
2 SASI_Hs01_00044975 predicted 972
3 SASI_Hs01_00044978 predicted 961
4 SASI_Hs01_00044979 predicted 842
5 SASI_Hs01_00044980 predicted 617
6 SASI_Hs02_00331645 predicted 699
7 SASI_Hs01_00044981 predicted 1018
8 SASI_Hs01_00044982 predicted 798
9 SASI_Hs01_00044983 predicted 810
10 SASI_Hs02_00331646 predicted 1053
11 SASI_Hs01_00044976 predicted 772
12 SASI_Hs01_00044977 predicted 989
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177662 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048203 predicted 936
2 SASI_Mm01_00048205 predicted 459
3 SASI_Mm01_00048206 predicted 213
4 SASI_Mm02_00347955 predicted 263
5 SASI_Mm02_00347956 predicted 699
6 SASI_Mm01_00048207 predicted 1072
7 SASI_Mm01_00048208 predicted 366
8 SASI_Mm01_00048209 predicted 1079
9 SASI_Mm01_00048210 predicted 441
10 SASI_Mm01_00048211 predicted 586
11 SASI_Mm01_00048204 predicted 639
12 SASI_Mm01_00048212 predicted 979
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177662
CTSO MISSION shRNA Bacterial Glycerol Stock
cathepsin O
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177662.1-830s1c1
Sequence:CCGGGCCGTTCTCATCACAGGCTTTCTCGAGAAAGCCTGTGATGAGAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177662.1-645s1c1
Sequence:CCGGCTCAATCACAAGCTGGAGTTTCTCGAGAAACTCCAGCTTGTGATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177662.1-266s1c1
Sequence:CCGGGCTTTGTATTTAGGCAGCAAACTCGAGTTTGCTGCCTAAATACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177662.1-463s1c1
Sequence:CCGGCCAAGGGAAATCTCTGGATTACTCGAGTAATCCAGAGATTTCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177662.1-210s1c1
Sequence:CCGGCCACTGCCTTCTATGGAGTAACTCGAGTTACTCCATAGAAGGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177662
CTSO MISSION shRNA shRNA Plasmid DNA
cathepsin O
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177662.1-830s1c1
Sequence:CCGGGCCGTTCTCATCACAGGCTTTCTCGAGAAAGCCTGTGATGAGAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177662.1-645s1c1
Sequence:CCGGCTCAATCACAAGCTGGAGTTTCTCGAGAAACTCCAGCTTGTGATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177662.1-266s1c1
Sequence:CCGGGCTTTGTATTTAGGCAGCAAACTCGAGTTTGCTGCCTAAATACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177662.1-463s1c1
Sequence:CCGGCCAAGGGAAATCTCTGGATTACTCGAGTAATCCAGAGATTTCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177662.1-210s1c1
Sequence:CCGGCCACTGCCTTCTATGGAGTAACTCGAGTTACTCCATAGAAGGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177662
CTSO MISSION shRNA Lentiviral Transduction Particles
cathepsin O
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177662.1-830s1c1
Sequence:CCGGGCCGTTCTCATCACAGGCTTTCTCGAGAAAGCCTGTGATGAGAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177662.1-645s1c1
Sequence:CCGGCTCAATCACAAGCTGGAGTTTCTCGAGAAACTCCAGCTTGTGATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177662.1-266s1c1
Sequence:CCGGGCTTTGTATTTAGGCAGCAAACTCGAGTTTGCTGCCTAAATACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177662.1-463s1c1
Sequence:CCGGCCAAGGGAAATCTCTGGATTACTCGAGTAATCCAGAGATTTCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177662.1-210s1c1
Sequence:CCGGCCACTGCCTTCTATGGAGTAACTCGAGTTACTCCATAGAAGGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001334
CTSO MISSION shRNA Bacterial Glycerol Stock
cathepsin O
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001334.2-857s1c1
Sequence:CCGGGCAGTTCTCATAACTGGGTTTCTCGAGAAACCCAGTTATGAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001334.2-237s1c1
Sequence:CCGGCCACCGCCTTCTATGGAATAACTCGAGTTATTCCATAGAAGGCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001334.2-360s1c1
Sequence:CCGGCCAATGTGTCTTTGCCGTTAACTCGAGTTAACGGCAAAGACACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001334.2-767s1c1
Sequence:CCGGCCTTTGGTAGTCATAGTAGATCTCGAGATCTACTATGACTACCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001334.2-896s1c1
Sequence:CCGGCCATATTGGATTGTGCGGAATCTCGAGATTCCGCACAATCCAATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001334.2-1252s21c1
Sequence:CCGGTTCCTGTCCTGAGACGAAATTCTCGAGAATTTCGTCTCAGGACAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001334.2-577s21c1
Sequence:CCGGCAATGCTTTGAACTGGTTAAACTCGAGTTTAACCAGTTCAAAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001334
CTSO MISSION shRNA shRNA Plasmid DNA
cathepsin O
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001334.2-857s1c1
Sequence:CCGGGCAGTTCTCATAACTGGGTTTCTCGAGAAACCCAGTTATGAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001334.2-237s1c1
Sequence:CCGGCCACCGCCTTCTATGGAATAACTCGAGTTATTCCATAGAAGGCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001334.2-360s1c1
Sequence:CCGGCCAATGTGTCTTTGCCGTTAACTCGAGTTAACGGCAAAGACACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001334.2-767s1c1
Sequence:CCGGCCTTTGGTAGTCATAGTAGATCTCGAGATCTACTATGACTACCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001334.2-896s1c1
Sequence:CCGGCCATATTGGATTGTGCGGAATCTCGAGATTCCGCACAATCCAATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001334.2-1252s21c1
Sequence:CCGGTTCCTGTCCTGAGACGAAATTCTCGAGAATTTCGTCTCAGGACAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001334.2-577s21c1
Sequence:CCGGCAATGCTTTGAACTGGTTAAACTCGAGTTTAACCAGTTCAAAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001334
CTSO MISSION shRNA Lentiviral Transduction Particles
cathepsin O
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001334.2-857s1c1
Sequence:CCGGGCAGTTCTCATAACTGGGTTTCTCGAGAAACCCAGTTATGAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001334.2-237s1c1
Sequence:CCGGCCACCGCCTTCTATGGAATAACTCGAGTTATTCCATAGAAGGCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001334.2-360s1c1
Sequence:CCGGCCAATGTGTCTTTGCCGTTAACTCGAGTTAACGGCAAAGACACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001334.2-767s1c1
Sequence:CCGGCCTTTGGTAGTCATAGTAGATCTCGAGATCTACTATGACTACCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001334.2-896s1c1
Sequence:CCGGCCATATTGGATTGTGCGGAATCTCGAGATTCCGCACAATCCAATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001334.2-1252s21c1
Sequence:CCGGTTCCTGTCCTGAGACGAAATTCTCGAGAATTTCGTCTCAGGACAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001334.2-577s21c1
Sequence:CCGGCAATGCTTTGAACTGGTTAAACTCGAGTTTAACCAGTTCAAAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks