EMAIL THIS PAGE TO A FRIEND

CTSS

cathepsin S

123 Gene Product Result for
UniProtKB ID: P25774, B4DWC9, D3DV05, Q5T5I0, Q6FHS5, Q9BUG3
Gene ID:
Human(1520) Summary: The protein encoded by this gene, a member of the peptidase C1 family, is a lysosomal cysteine proteinase that may participate in the degradation of antigenic proteins to peptides for presentation on MHC class II molecules. The encoded protein can function as an elastase over a broad pH range in alveolar macrophages. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
Mouse(13040) cathepsin S
Rat(50654) cathepsin S
sheep(780472) cathepsin S
chicken(425657) cathepsin S
cow(327711) cathepsin S
dog(403400) cathepsin S
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK202 Cathepsin S Inhibitor Screening Kit Sufficient for 100 Fluorometric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021281 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021281 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021281 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004079 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004079 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004079 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU001241 MISSION® esiRNA esiRNA targeting human CTSS (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004079 Rosetta Predictions human pricing
NM_017320 Rosetta Predictions rat pricing
NM_021281 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004079 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021190 predicted 945
2 SASI_Hs01_00021192 predicted 983
3 SASI_Hs01_00021193 predicted 344
4 SASI_Hs01_00021194 predicted 841
5 SASI_Hs01_00021195 predicted 444
6 SASI_Hs01_00021196 predicted 918
7 SASI_Hs01_00021197 predicted 739
8 SASI_Hs02_00336877 predicted 989
9 SASI_Hs01_00021198 predicted 756
10 SASI_Hs01_00021199 predicted 853
11 SASI_Hs01_00021191 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017320 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059454 predicted 286
2 SASI_Rn01_00059455 predicted 799
3 SASI_Rn01_00059456 predicted 1000
4 SASI_Rn01_00059457 predicted 987
5 SASI_Rn01_00059458 predicted 1000
6 SASI_Rn01_00059459 predicted 628
7 SASI_Rn01_00059460 predicted 713
8 SASI_Rn01_00059461 predicted 239
9 SASI_Rn01_00059462 predicted 331
10 SASI_Rn01_00059463 predicted 208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021281 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325804 predicted 1102
2 SASI_Mm02_00325805 predicted 358
3 SASI_Mm02_00325806 predicted 241
4 SASI_Mm01_00058465 predicted 962
5 SASI_Mm01_00058466 predicted 1113
6 SASI_Mm02_00325807 predicted 748
7 SASI_Mm01_00058467 predicted 845
8 SASI_Mm01_00058470 predicted 861
9 SASI_Mm01_00058471 predicted 1096
10 SASI_Mm01_00058472 predicted 299
11 SASI_Mm01_00058464 predicted 983
12 SASI_Mm01_00058468 predicted 362
13 SASI_Mm01_00058469 predicted 692
14 SASI_Mm01_00058473 predicted 938
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021281
CTSS MISSION shRNA Bacterial Glycerol Stock
cathepsin S
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021281.1-1124s1c1
Sequence:CCGGCTAACTTAATTTGCCTGCAATCTCGAGATTGCAGGCAAATTAAGTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021281.1-404s1c1
Sequence:CCGGGTCATACTCTAATCGGACATTCTCGAGAATGTCCGATTAGAGTATGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021281.1-1038s1c1
Sequence:CCGGCACTGCGGAATTGCTAGTTATCTCGAGATAACTAGCAATTCCGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021281.1-158s1c1
Sequence:CCGGCCATTGGGATCTCTGGAAGAACTCGAGTTCTTCCAGAGATCCCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021281.1-1123s1c1
Sequence:CCGGTCTAACTTAATTTGCCTGCAACTCGAGTTGCAGGCAAATTAAGTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021281.1-463s1c1
Sequence:CCGGCTGAGGTGAAATACCAGGGTTCTCGAGAACCCTGGTATTTCACCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021281.1-747s1c1
Sequence:CCGGGCTACGTGTTCAAGGTACATTCTCGAGAATGTACCTTGAACACGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021281.1-1014s1c1
Sequence:CCGGCGGATGGCAAGAAATAATAAACTCGAGTTTATTATTTCTTGCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021281.1-308s1c1
Sequence:CCGGCATGAACGATATGGGAGACATCTCGAGATGTCTCCCATATCGTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021281
CTSS MISSION shRNA shRNA Plasmid DNA
cathepsin S
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021281.1-1124s1c1
Sequence:CCGGCTAACTTAATTTGCCTGCAATCTCGAGATTGCAGGCAAATTAAGTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021281.1-404s1c1
Sequence:CCGGGTCATACTCTAATCGGACATTCTCGAGAATGTCCGATTAGAGTATGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021281.1-1038s1c1
Sequence:CCGGCACTGCGGAATTGCTAGTTATCTCGAGATAACTAGCAATTCCGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021281.1-158s1c1
Sequence:CCGGCCATTGGGATCTCTGGAAGAACTCGAGTTCTTCCAGAGATCCCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021281.1-1123s1c1
Sequence:CCGGTCTAACTTAATTTGCCTGCAACTCGAGTTGCAGGCAAATTAAGTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021281.1-463s1c1
Sequence:CCGGCTGAGGTGAAATACCAGGGTTCTCGAGAACCCTGGTATTTCACCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021281.1-747s1c1
Sequence:CCGGGCTACGTGTTCAAGGTACATTCTCGAGAATGTACCTTGAACACGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021281.1-1014s1c1
Sequence:CCGGCGGATGGCAAGAAATAATAAACTCGAGTTTATTATTTCTTGCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021281.1-308s1c1
Sequence:CCGGCATGAACGATATGGGAGACATCTCGAGATGTCTCCCATATCGTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021281
CTSS MISSION shRNA Lentiviral Transduction Particles
cathepsin S
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021281.1-1124s1c1
Sequence:CCGGCTAACTTAATTTGCCTGCAATCTCGAGATTGCAGGCAAATTAAGTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021281.1-404s1c1
Sequence:CCGGGTCATACTCTAATCGGACATTCTCGAGAATGTCCGATTAGAGTATGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021281.1-1038s1c1
Sequence:CCGGCACTGCGGAATTGCTAGTTATCTCGAGATAACTAGCAATTCCGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021281.1-158s1c1
Sequence:CCGGCCATTGGGATCTCTGGAAGAACTCGAGTTCTTCCAGAGATCCCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021281.1-1123s1c1
Sequence:CCGGTCTAACTTAATTTGCCTGCAACTCGAGTTGCAGGCAAATTAAGTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021281.1-463s1c1
Sequence:CCGGCTGAGGTGAAATACCAGGGTTCTCGAGAACCCTGGTATTTCACCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021281.1-747s1c1
Sequence:CCGGGCTACGTGTTCAAGGTACATTCTCGAGAATGTACCTTGAACACGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021281.1-1014s1c1
Sequence:CCGGCGGATGGCAAGAAATAATAAACTCGAGTTTATTATTTCTTGCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021281.1-308s1c1
Sequence:CCGGCATGAACGATATGGGAGACATCTCGAGATGTCTCCCATATCGTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004079
VALIDATED
CTSS MISSION shRNA Bacterial Glycerol Stock
cathepsin S
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004079.x-447s1c1
Sequence:CCGGTCACATATAAGTCAAACCCTACTCGAGTAGGGTTTGACTTATATGTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003693    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004079.x-3537s1c1
Sequence:CCGGCAGCACTTTGACATATTGAATCTCGAGATTCAATATGTCAAAGTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004079.x-695s1c1
Sequence:CCGGGCTTTCCAGTACATCATTGATCTCGAGATCAATGATGTACTGGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004079.x-180s1c1
Sequence:CCGGCACAGTTGCATAAAGATCCTACTCGAGTAGGATCTTTATGCAACTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004079.x-984s1c1
Sequence:CCGGGCTATGGTGATCTTAATGGGACTCGAGTCCCATTAAGATCACCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004079.3-180s21c1
Sequence:CCGGCACAGTTGCATAAAGATCCTACTCGAGTAGGATCTTTATGCAACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004079.3-3537s21c1
Sequence:CCGGCAGCACTTTGACATATTGAATCTCGAGATTCAATATGTCAAAGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004079.3-695s21c1
Sequence:CCGGGCTTTCCAGTACATCATTGATCTCGAGATCAATGATGTACTGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004079.3-984s21c1
Sequence:CCGGGCTATGGTGATCTTAATGGGACTCGAGTCCCATTAAGATCACCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004079
VALIDATED
CTSS MISSION shRNA shRNA Plasmid DNA
cathepsin S
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004079.x-447s1c1
Sequence:CCGGTCACATATAAGTCAAACCCTACTCGAGTAGGGTTTGACTTATATGTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003693    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004079.x-3537s1c1
Sequence:CCGGCAGCACTTTGACATATTGAATCTCGAGATTCAATATGTCAAAGTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004079.x-695s1c1
Sequence:CCGGGCTTTCCAGTACATCATTGATCTCGAGATCAATGATGTACTGGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004079.x-180s1c1
Sequence:CCGGCACAGTTGCATAAAGATCCTACTCGAGTAGGATCTTTATGCAACTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004079.x-984s1c1
Sequence:CCGGGCTATGGTGATCTTAATGGGACTCGAGTCCCATTAAGATCACCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004079.3-180s21c1
Sequence:CCGGCACAGTTGCATAAAGATCCTACTCGAGTAGGATCTTTATGCAACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004079.3-3537s21c1
Sequence:CCGGCAGCACTTTGACATATTGAATCTCGAGATTCAATATGTCAAAGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004079.3-695s21c1
Sequence:CCGGGCTTTCCAGTACATCATTGATCTCGAGATCAATGATGTACTGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004079.3-984s21c1
Sequence:CCGGGCTATGGTGATCTTAATGGGACTCGAGTCCCATTAAGATCACCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004079
VALIDATED
CTSS MISSION shRNA Lentiviral Transduction Particles
cathepsin S
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004079.x-447s1c1
Sequence:CCGGTCACATATAAGTCAAACCCTACTCGAGTAGGGTTTGACTTATATGTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003693    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004079.x-3537s1c1
Sequence:CCGGCAGCACTTTGACATATTGAATCTCGAGATTCAATATGTCAAAGTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004079.x-695s1c1
Sequence:CCGGGCTTTCCAGTACATCATTGATCTCGAGATCAATGATGTACTGGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004079.x-180s1c1
Sequence:CCGGCACAGTTGCATAAAGATCCTACTCGAGTAGGATCTTTATGCAACTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004079.x-984s1c1
Sequence:CCGGGCTATGGTGATCTTAATGGGACTCGAGTCCCATTAAGATCACCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004079.3-180s21c1
Sequence:CCGGCACAGTTGCATAAAGATCCTACTCGAGTAGGATCTTTATGCAACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004079.3-3537s21c1
Sequence:CCGGCAGCACTTTGACATATTGAATCTCGAGATTCAATATGTCAAAGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004079.3-695s21c1
Sequence:CCGGGCTTTCCAGTACATCATTGATCTCGAGATCAATGATGTACTGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004079.3-984s21c1
Sequence:CCGGGCTATGGTGATCTTAATGGGACTCGAGTCCCATTAAGATCACCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks