EMAIL THIS PAGE TO A FRIEND

CTSV

cathepsin V

31 Gene Product Result for
Synonyms: CATL2 CTSL2 CTSU
Species: Human CTSV(1515)
Gene ID:
Human(1515) Summary: The protein encoded by this gene, a member of the peptidase C1 family, is a lysosomal cysteine proteinase that may play an important role in corneal physiology. This gene is expressed in colorectal and breast carcinomas but not in normal colon, mammary gland, or peritumoral tissues, suggesting a possible role for this gene in tumor processes. Alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2011]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001333 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001333 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001333 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU064031 MISSION® esiRNA esiRNA human CTSL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001333 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001333 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206812 predicted 272
2 SASI_Hs01_00206813 predicted 523
3 SASI_Hs01_00206814 predicted 402
4 SASI_Hs01_00206815 predicted 308
5 SASI_Hs01_00206816 predicted 1220
6 SASI_Hs01_00206817 predicted 796
7 SASI_Hs01_00206818 predicted 469
8 SASI_Hs01_00206819 predicted 577
9 SASI_Hs01_00206820 predicted 956
10 SASI_Hs01_00206821 predicted 815
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001333
VALIDATED
CTSV MISSION shRNA Bacterial Glycerol Stock
cathepsin V
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001333.2-1262s21c1
Sequence:CCGGGAAACTGACCAAACGCTTATTCTCGAGAATAAGCGTTTGGTCAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001333.2-297s21c1
Sequence:CCGGGCAACACACAGAAGATTATATCTCGAGATATAATCTTCTGTGTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001333.2-1067s21c1
Sequence:CCGGTTCGAATAACAGCAAGTATTGCTCGAGCAATACTTGCTGTTATTCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001333.2-960s21c1
Sequence:CCGGTCGTCCTTCCAGTTCTACAAACTCGAGTTTGTAGAACTGGAAGGACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003639    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001333.x-1262s1c1
Sequence:CCGGGAAACTGACCAAACGCTTATTCTCGAGAATAAGCGTTTGGTCAGTTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001333.x-960s1c1
Sequence:CCGGTCGTCCTTCCAGTTCTACAAACTCGAGTTTGTAGAACTGGAAGGACGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001333.x-297s1c1
Sequence:CCGGGCAACACACAGAAGATTATATCTCGAGATATAATCTTCTGTGTGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001333.x-305s1c1
Sequence:CCGGCAGAAGATTATATGGCGCGAACTCGAGTTCGCGCCATATAATCTTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001333
VALIDATED
CTSV MISSION shRNA shRNA Plasmid DNA
cathepsin V
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001333.2-1262s21c1
Sequence:CCGGGAAACTGACCAAACGCTTATTCTCGAGAATAAGCGTTTGGTCAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001333.2-297s21c1
Sequence:CCGGGCAACACACAGAAGATTATATCTCGAGATATAATCTTCTGTGTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001333.2-1067s21c1
Sequence:CCGGTTCGAATAACAGCAAGTATTGCTCGAGCAATACTTGCTGTTATTCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001333.2-960s21c1
Sequence:CCGGTCGTCCTTCCAGTTCTACAAACTCGAGTTTGTAGAACTGGAAGGACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003639    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001333.x-1262s1c1
Sequence:CCGGGAAACTGACCAAACGCTTATTCTCGAGAATAAGCGTTTGGTCAGTTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001333.x-960s1c1
Sequence:CCGGTCGTCCTTCCAGTTCTACAAACTCGAGTTTGTAGAACTGGAAGGACGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001333.x-297s1c1
Sequence:CCGGGCAACACACAGAAGATTATATCTCGAGATATAATCTTCTGTGTGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001333.x-305s1c1
Sequence:CCGGCAGAAGATTATATGGCGCGAACTCGAGTTCGCGCCATATAATCTTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001333
VALIDATED
CTSV MISSION shRNA Lentiviral Transduction Particles
cathepsin V
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001333.2-1262s21c1
Sequence:CCGGGAAACTGACCAAACGCTTATTCTCGAGAATAAGCGTTTGGTCAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001333.2-297s21c1
Sequence:CCGGGCAACACACAGAAGATTATATCTCGAGATATAATCTTCTGTGTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001333.2-1067s21c1
Sequence:CCGGTTCGAATAACAGCAAGTATTGCTCGAGCAATACTTGCTGTTATTCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001333.2-960s21c1
Sequence:CCGGTCGTCCTTCCAGTTCTACAAACTCGAGTTTGTAGAACTGGAAGGACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003639    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001333.x-1262s1c1
Sequence:CCGGGAAACTGACCAAACGCTTATTCTCGAGAATAAGCGTTTGGTCAGTTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001333.x-960s1c1
Sequence:CCGGTCGTCCTTCCAGTTCTACAAACTCGAGTTTGTAGAACTGGAAGGACGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001333.x-297s1c1
Sequence:CCGGGCAACACACAGAAGATTATATCTCGAGATATAATCTTCTGTGTGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001333.x-305s1c1
Sequence:CCGGCAGAAGATTATATGGCGCGAACTCGAGTTCGCGCCATATAATCTTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)