EMAIL THIS PAGE TO A FRIEND

CTSW

cathepsin W

55 Gene Product Result for
Synonyms: LYPN
UniProtKB ID: P56202, Q86VT4
Gene ID:
Human(1521) Summary: The protein encoded by this gene, a member of the peptidase C1 family, is a cysteine proteinase that may have a specific function in the mechanism or regulation of T-cell cytolytic activity. The encoded protein is found associated with the membrane inside the endoplasmic reticulum of natural killer and cytotoxic T-cells. Expression of this gene is up-regulated by interleukin-2. [provided by RefSeq, Jul 2008]
Mouse(13041) cathepsin W
Rat(293676) cathepsin W
cow(510967) cathepsin W
dog(483725) cathepsin W
sheep(101110464) cathepsin W
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
WH0001521M1 Monoclonal Anti-CTSW antibody produced in mouse clone 4A8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001335 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001335 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001335 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009985 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009985 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009985 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001335 Rosetta Predictions human pricing
NM_001024242 Rosetta Predictions rat pricing
NM_009985 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001335 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171839 predicted 634
2 SASI_Hs01_00171840 predicted 770
3 SASI_Hs01_00171841 predicted 538
4 SASI_Hs01_00171842 predicted 385
5 SASI_Hs01_00171843 predicted 457
6 SASI_Hs01_00171844 predicted 969
7 SASI_Hs01_00171846 predicted 634
8 SASI_Hs01_00171847 predicted 413
9 SASI_Hs02_00331647 predicted 914
10 SASI_Hs01_00171848 predicted 277
11 SASI_Hs01_00171845 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024242 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063295 predicted 801
2 SASI_Rn01_00063296 predicted 772
3 SASI_Rn01_00063297 predicted 710
4 SASI_Rn01_00063298 predicted 817
5 SASI_Rn02_00202391 predicted 317
6 SASI_Rn02_00202392 predicted 872
7 SASI_Rn01_00063300 predicted 322
8 SASI_Rn01_00063301 predicted 791
9 SASI_Rn01_00063303 predicted 718
10 SASI_Rn01_00063304 predicted 574
11 SASI_Rn01_00063299 predicted 710
12 SASI_Rn01_00063302 predicted 1024
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009985 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025372 predicted 736
2 SASI_Mm01_00025373 predicted 563
3 SASI_Mm02_00317581 predicted 493
4 SASI_Mm01_00025374 predicted 609
5 SASI_Mm01_00025375 predicted 442
6 SASI_Mm01_00025376 predicted 724
7 SASI_Mm01_00025377 predicted 480
8 SASI_Mm01_00025378 predicted 928
9 SASI_Mm01_00025379 predicted 794
10 SASI_Mm01_00025380 predicted 799
11 SASI_Mm01_00025381 predicted 506
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001335
CTSW MISSION shRNA Bacterial Glycerol Stock
cathepsin W
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001335.x-466s1c1
Sequence:CCGGTCACCCATCAAGGACCAGAAACTCGAGTTTCTGGTCCTTGATGGGTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001335.x-772s1c1
Sequence:CCGGCAGAACAACGAGCACAGAATTCTCGAGAATTCTGTGCTCGTTGTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001335.x-698s1c1
Sequence:CCGGGCAAAGTCAGAGCCCACAGGTCTCGAGACCTGTGGGCTCTGACTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001335.x-1244s1c1
Sequence:CCGGCCCATCCTCCCAATCTCAATACTCGAGTATTGAGATTGGGAGGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001335.x-1128s1c1
Sequence:CCGGTGTGCAGAAACCGGATATGAACTCGAGTTCATATCCGGTTTCTGCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001335.3-181s21c1
Sequence:CCGGATCCAGTTCAACCGGAGTTACCTCGAGGTAACTCCGGTTGAACTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001335.3-281s21c1
Sequence:CCGGACTTGGGCACAGCTGAGTTTGCTCGAGCAAACTCAGCTGTGCCCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001335
CTSW MISSION shRNA shRNA Plasmid DNA
cathepsin W
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001335.x-466s1c1
Sequence:CCGGTCACCCATCAAGGACCAGAAACTCGAGTTTCTGGTCCTTGATGGGTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001335.x-772s1c1
Sequence:CCGGCAGAACAACGAGCACAGAATTCTCGAGAATTCTGTGCTCGTTGTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001335.x-698s1c1
Sequence:CCGGGCAAAGTCAGAGCCCACAGGTCTCGAGACCTGTGGGCTCTGACTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001335.x-1244s1c1
Sequence:CCGGCCCATCCTCCCAATCTCAATACTCGAGTATTGAGATTGGGAGGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001335.x-1128s1c1
Sequence:CCGGTGTGCAGAAACCGGATATGAACTCGAGTTCATATCCGGTTTCTGCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001335.3-181s21c1
Sequence:CCGGATCCAGTTCAACCGGAGTTACCTCGAGGTAACTCCGGTTGAACTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001335.3-281s21c1
Sequence:CCGGACTTGGGCACAGCTGAGTTTGCTCGAGCAAACTCAGCTGTGCCCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001335
CTSW MISSION shRNA Lentiviral Transduction Particles
cathepsin W
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001335.x-466s1c1
Sequence:CCGGTCACCCATCAAGGACCAGAAACTCGAGTTTCTGGTCCTTGATGGGTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001335.x-772s1c1
Sequence:CCGGCAGAACAACGAGCACAGAATTCTCGAGAATTCTGTGCTCGTTGTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001335.x-698s1c1
Sequence:CCGGGCAAAGTCAGAGCCCACAGGTCTCGAGACCTGTGGGCTCTGACTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001335.x-1244s1c1
Sequence:CCGGCCCATCCTCCCAATCTCAATACTCGAGTATTGAGATTGGGAGGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001335.x-1128s1c1
Sequence:CCGGTGTGCAGAAACCGGATATGAACTCGAGTTCATATCCGGTTTCTGCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001335.3-181s21c1
Sequence:CCGGATCCAGTTCAACCGGAGTTACCTCGAGGTAACTCCGGTTGAACTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001335.3-281s21c1
Sequence:CCGGACTTGGGCACAGCTGAGTTTGCTCGAGCAAACTCAGCTGTGCCCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009985
CTSW MISSION shRNA Bacterial Glycerol Stock
cathepsin W
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009985.2-604s1c1
Sequence:CCGGCGCATATCTAACTGTCCTCAACTCGAGTTGAGGACAGTTAGATATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009985.2-412s1c1
Sequence:CCGGGCGTAAAGCAAAGAACATCATCTCGAGATGATGTTCTTTGCTTTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009985.2-973s1c1
Sequence:CCGGCCCATACTGGATCCTGAAGAACTCGAGTTCTTCAGGATCCAGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009985.2-804s1c1
Sequence:CCGGACATGAAACTACTCCAGCATTCTCGAGAATGCTGGAGTAGTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009985.2-688s1c1
Sequence:CCGGCCTAGCCAAGAAGTACAAGAACTCGAGTTCTTGTACTTCTTGGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009985
CTSW MISSION shRNA shRNA Plasmid DNA
cathepsin W
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009985.2-604s1c1
Sequence:CCGGCGCATATCTAACTGTCCTCAACTCGAGTTGAGGACAGTTAGATATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009985.2-412s1c1
Sequence:CCGGGCGTAAAGCAAAGAACATCATCTCGAGATGATGTTCTTTGCTTTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009985.2-973s1c1
Sequence:CCGGCCCATACTGGATCCTGAAGAACTCGAGTTCTTCAGGATCCAGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009985.2-804s1c1
Sequence:CCGGACATGAAACTACTCCAGCATTCTCGAGAATGCTGGAGTAGTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009985.2-688s1c1
Sequence:CCGGCCTAGCCAAGAAGTACAAGAACTCGAGTTCTTGTACTTCTTGGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009985
CTSW MISSION shRNA Lentiviral Transduction Particles
cathepsin W
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009985.2-604s1c1
Sequence:CCGGCGCATATCTAACTGTCCTCAACTCGAGTTGAGGACAGTTAGATATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009985.2-412s1c1
Sequence:CCGGGCGTAAAGCAAAGAACATCATCTCGAGATGATGTTCTTTGCTTTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009985.2-973s1c1
Sequence:CCGGCCCATACTGGATCCTGAAGAACTCGAGTTCTTCAGGATCCAGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009985.2-804s1c1
Sequence:CCGGACATGAAACTACTCCAGCATTCTCGAGAATGCTGGAGTAGTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009985.2-688s1c1
Sequence:CCGGCCTAGCCAAGAAGTACAAGAACTCGAGTTCTTGTACTTCTTGGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks