EMAIL THIS PAGE TO A FRIEND

CTSZ

cathepsin Z

57 Gene Product Result for
Synonyms: CTSX
UniProtKB ID: Q9UBR2, B2RC40, O75331, Q9UQV5, Q9UQV6
Gene ID:
Human(1522) Summary: The protein encoded by this gene is a lysosomal cysteine proteinase and member of the peptidase C1 family. It exhibits both carboxy-monopeptidase and carboxy-dipeptidase activities. The encoded protein has also been known as cathepsin X and cathepsin P. This gene is expressed ubiquitously in cancer cell lines and primary tumors and, like other members of this family, may be involved in tumorigenesis. [provided by RefSeq, Oct 2008]
Mouse(64138) cathepsin Z
Rat(252929) cathepsin Z
Zebrafish(450022) cathepsin Z
chicken(419311) cathepsin Z
cow(404187) cathepsin Z
dog(611983) cathepsin Z
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001336 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001336 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001336 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022325 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022325 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022325 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001336 Rosetta Predictions human pricing
NM_183330 Rosetta Predictions rat pricing
NM_022325 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001336 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117359 predicted 622
2 SASI_Hs01_00117360 predicted 420
3 SASI_Hs01_00117361 predicted 567
4 SASI_Hs01_00117362 predicted 1170
5 SASI_Hs02_00331648 predicted 753
6 SASI_Hs01_00117363 predicted 1025
7 SASI_Hs01_00117364 predicted 945
8 SASI_Hs01_00117365 predicted 806
9 SASI_Hs01_00117366 predicted 869
10 SASI_Hs01_00117367 predicted 792
11 SASI_Hs01_00117358 predicted 609
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183330 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032947 predicted 954
2 SASI_Rn01_00032948 predicted 944
3 SASI_Rn02_00269884 predicted 317
4 SASI_Rn01_00032949 predicted 221
5 SASI_Rn01_00032950 predicted 767
6 SASI_Rn01_00032951 predicted 321
7 SASI_Rn01_00032952 predicted 850
8 SASI_Rn01_00032953 predicted 727
9 SASI_Rn01_00032954 predicted 917
10 SASI_Rn01_00032955 predicted 831
11 SASI_Rn01_00032956 predicted 1062
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022325 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166877 predicted 954
2 SASI_Mm01_00166878 predicted 752
3 SASI_Mm02_00326561 predicted 241
4 SASI_Mm02_00326562 predicted 802
5 SASI_Mm01_00166879 predicted 1059
6 SASI_Mm01_00166880 predicted 295
7 SASI_Mm02_00326563 predicted 750
8 SASI_Mm01_00166884 predicted 858
9 SASI_Mm02_00326564 predicted 802
10 SASI_Mm02_00326565 predicted 242
11 SASI_Mm01_00166876 predicted 247
12 SASI_Mm01_00166881 predicted 242
13 SASI_Mm01_00166882 predicted 781
14 SASI_Mm01_00166883 predicted 302
15 SASI_Mm01_00166885 predicted 245
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001336
VALIDATED
CTSZ MISSION shRNA Bacterial Glycerol Stock
cathepsin Z
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001336.3-948s21c1
Sequence:CCGGGATCGTGACCAGCACCTATAACTCGAGTTATAGGTGCTGGTCACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001336.3-825s21c1
Sequence:CCGGCCAGGACACCACATATATAAACTCGAGTTTATATATGTGGTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001336.3-1191s21c1
Sequence:CCGGCCTGAGAGTTGAAAGTGGGATCTCGAGATCCCACTTTCAACTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001336.3-332s21c1
Sequence:CCGGGCAATGTGGATGGTGTCAACTCTCGAGAGTTGACACCATCCACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001336.3-797s21c1
Sequence:CCGGACTACACCGGAGGCATCTATGCTCGAGCATAGATGCCTCCGGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001336.x-818s1c1
Sequence:CCGGCGAATACCAGGACACCACATACTCGAGTATGTGGTGTCCTGGTATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003649    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001336.x-1190s1c1
Sequence:CCGGCCTGAGAGTTGAAAGTGGGATCTCGAGATCCCACTTTCAACTCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001336.x-824s1c1
Sequence:CCGGCCAGGACACCACATATATAAACTCGAGTTTATATATGTGGTGTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001336.x-331s1c1
Sequence:CCGGGCAATGTGGATGGTGTCAACTCTCGAGAGTTGACACCATCCACATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001336
VALIDATED
CTSZ MISSION shRNA shRNA Plasmid DNA
cathepsin Z
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001336.3-948s21c1
Sequence:CCGGGATCGTGACCAGCACCTATAACTCGAGTTATAGGTGCTGGTCACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001336.3-825s21c1
Sequence:CCGGCCAGGACACCACATATATAAACTCGAGTTTATATATGTGGTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001336.3-1191s21c1
Sequence:CCGGCCTGAGAGTTGAAAGTGGGATCTCGAGATCCCACTTTCAACTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001336.3-332s21c1
Sequence:CCGGGCAATGTGGATGGTGTCAACTCTCGAGAGTTGACACCATCCACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001336.3-797s21c1
Sequence:CCGGACTACACCGGAGGCATCTATGCTCGAGCATAGATGCCTCCGGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001336.x-818s1c1
Sequence:CCGGCGAATACCAGGACACCACATACTCGAGTATGTGGTGTCCTGGTATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003649    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001336.x-1190s1c1
Sequence:CCGGCCTGAGAGTTGAAAGTGGGATCTCGAGATCCCACTTTCAACTCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001336.x-824s1c1
Sequence:CCGGCCAGGACACCACATATATAAACTCGAGTTTATATATGTGGTGTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001336.x-331s1c1
Sequence:CCGGGCAATGTGGATGGTGTCAACTCTCGAGAGTTGACACCATCCACATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001336
VALIDATED
CTSZ MISSION shRNA Lentiviral Transduction Particles
cathepsin Z
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001336.3-948s21c1
Sequence:CCGGGATCGTGACCAGCACCTATAACTCGAGTTATAGGTGCTGGTCACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001336.3-825s21c1
Sequence:CCGGCCAGGACACCACATATATAAACTCGAGTTTATATATGTGGTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001336.3-1191s21c1
Sequence:CCGGCCTGAGAGTTGAAAGTGGGATCTCGAGATCCCACTTTCAACTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001336.3-332s21c1
Sequence:CCGGGCAATGTGGATGGTGTCAACTCTCGAGAGTTGACACCATCCACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001336.3-797s21c1
Sequence:CCGGACTACACCGGAGGCATCTATGCTCGAGCATAGATGCCTCCGGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001336.x-818s1c1
Sequence:CCGGCGAATACCAGGACACCACATACTCGAGTATGTGGTGTCCTGGTATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003649    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001336.x-1190s1c1
Sequence:CCGGCCTGAGAGTTGAAAGTGGGATCTCGAGATCCCACTTTCAACTCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001336.x-824s1c1
Sequence:CCGGCCAGGACACCACATATATAAACTCGAGTTTATATATGTGGTGTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001336.x-331s1c1
Sequence:CCGGGCAATGTGGATGGTGTCAACTCTCGAGAGTTGACACCATCCACATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022325
CTSZ MISSION shRNA Bacterial Glycerol Stock
cathepsin Z
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022325.3-410s1c1
Sequence:CCGGCGAATCAACATCAAGAGGAAACTCGAGTTTCCTCTTGATGTTGATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022325.3-805s1c1
Sequence:CCGGCCAGGCTGTTATCAACCACATCTCGAGATGTGGTTGATAACAGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022325.3-742s1c1
Sequence:CCGGCGGGATAATGGCAACAGAGATCTCGAGATCTCTGTTGCCATTATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022325.3-191s1c1
Sequence:CCGGCAGACTTGCTACCATCCCATTCTCGAGAATGGGATGGTAGCAAGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022325.3-550s1c1
Sequence:CCGGCGATGAGACCTGCAACAACTACTCGAGTAGTTGTTGCAGGTCTCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000455135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022325.4-977s21c1
Sequence:CCGGATCGAGAGTGCCTGCACATTTCTCGAGAAATGTGCAGGCACTCTCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022325
CTSZ MISSION shRNA shRNA Plasmid DNA
cathepsin Z
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022325.3-410s1c1
Sequence:CCGGCGAATCAACATCAAGAGGAAACTCGAGTTTCCTCTTGATGTTGATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022325.3-805s1c1
Sequence:CCGGCCAGGCTGTTATCAACCACATCTCGAGATGTGGTTGATAACAGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022325.3-742s1c1
Sequence:CCGGCGGGATAATGGCAACAGAGATCTCGAGATCTCTGTTGCCATTATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022325.3-191s1c1
Sequence:CCGGCAGACTTGCTACCATCCCATTCTCGAGAATGGGATGGTAGCAAGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022325.3-550s1c1
Sequence:CCGGCGATGAGACCTGCAACAACTACTCGAGTAGTTGTTGCAGGTCTCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000455135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022325.4-977s21c1
Sequence:CCGGATCGAGAGTGCCTGCACATTTCTCGAGAAATGTGCAGGCACTCTCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022325
CTSZ MISSION shRNA Lentiviral Transduction Particles
cathepsin Z
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022325.3-410s1c1
Sequence:CCGGCGAATCAACATCAAGAGGAAACTCGAGTTTCCTCTTGATGTTGATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022325.3-805s1c1
Sequence:CCGGCCAGGCTGTTATCAACCACATCTCGAGATGTGGTTGATAACAGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022325.3-742s1c1
Sequence:CCGGCGGGATAATGGCAACAGAGATCTCGAGATCTCTGTTGCCATTATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022325.3-191s1c1
Sequence:CCGGCAGACTTGCTACCATCCCATTCTCGAGAATGGGATGGTAGCAAGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022325.3-550s1c1
Sequence:CCGGCGATGAGACCTGCAACAACTACTCGAGTAGTTGTTGCAGGTCTCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000455135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022325.4-977s21c1
Sequence:CCGGATCGAGAGTGCCTGCACATTTCTCGAGAAATGTGCAGGCACTCTCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks