EMAIL THIS PAGE TO A FRIEND

CTTN

cortactin

112 Gene Product Result for
Synonyms: EMS1
UniProtKB ID: Q14247, Q8N707, Q96H99
Gene ID:
Human(2017) Summary: This gene is overexpressed in breast cancer and squamous cell carcinomas of the head and neck. The encoded protein is localized in the cytoplasm and in areas of the cell-substratum contacts. This gene has two roles: (1) regulating the interactions between components of adherens-type junctions and (2) organizing the cytoskeleton and cell adhesion structures of epithelia and carcinoma cells. During apoptosis, the encoded protein is degraded in a caspase-dependent manner. The aberrant regulation of this gene contributes to tumor cell invasion and metastasis. Three splice variants that encode different isoforms have been identified for this gene. [provided by RefSeq, May 2010]
Mouse(13043) cortactin
Rat(60465) cortactin
sheep(101117549) cortactin
Zebrafish(445561) cortactin
cow(506939) cortactin
Horse(100147634) cortactin
dog(610283) cortactin
chicken(396455) cortactin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C6987 Anti-Cortactin (GK-18) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, rat, chicken, human
immunofluorescence, microarray, western blot pricing
C7112 Anti-Cortactin (KE-20) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse, chicken, rat
immunofluorescence, western blot pricing
SAB4500765 Anti-Cortactin antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4500766 Anti-Cortactin, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB2500265 Anti-Cortactin/EMS1 antibody produced in goat affinity isolated antibody, buffered aqueous solution bovine, canine, mouse, human, rat
ELISA, western blot pricing
SAB4300517 Anti-CTTN (Ab-421) antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry pricing
SAB4300518 Anti-CTTN (Ab-466) antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
AV52067 Anti-CTTN antibody produced in rabbit affinity isolated antibody canine, bovine, horse, mouse, rat, guinea pig, zebrafish, human, rabbit
western blot pricing
HPA057242 Anti-CTTN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
C0739 Anti-phospho-Cortactin (pTyr421) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution mouse
immunocytochemistry, western blot pricing
SAB4504372 Anti-phospho-Cortactin (pTyr421) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
C0864 Anti-phospho-Cortactin (pTyr466) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse
western blot pricing
SAB4504373 Anti-phospho-Cortactin (pTyr466) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4300216 Anti-phospho-CTTN (pTyr466) antibody produced in rabbit affinity isolated antibody human, mouse
western blot pricing
SAB1306445 ANTI-SRC8(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1305513 MONOCLONAL ANTI-CORTACTIN antibody produced in mouse clone 401CT8.6.3, crude ascites, buffered aqueous solution human
western blot pricing
SAB5300316 Monoclonal Anti-CTTN antibody produced in mouse clone 4C6, ascites fluid human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB1402182 Monoclonal Anti-CTTN antibody produced in mouse clone 2B5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005231 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005231 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005231 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007803 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007803 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007803 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
09-881 Anti-acetyl Cortactin Antibody 100 µg, This Anti-acetyl Cortactin Antibody is validated for use in Western Blotting, for the detection of acetyl Cortactin. pricing
ABT1378 Anti-Acetyl Cortactin (Lys309) 100 µL, This rabbit polyclonal Anti-Acetyl Cortactin (Lys309), Cat. No. ABT1378 detects Src substrate cortactin and is tested for use in Immunofluorescence and Western Blotting. pricing
AB3887 Anti-Cortactin Antibody 100 µg, Detect Cortactin using this Anti-Cortactin Antibody validated for use in WB. pricing
AB3852 Anti-Cortactin Antibody, phospho-specific (Tyr421) 100 µg, Anti-Cortactin Antibody, phospho-specific (Tyr421) detects level of Cortactin & has been published & validated for use in WB. pricing
AB3853 Anti-Cortactin Antibody, phospho-specific (Tyr486) 100 µg, Anti-Cortactin Antibody, phospho-specific (Tyr486) is an antibody against Cortactin for use in WB. pricing
05-180 Anti-Cortactin (p80/85) Antibody, clone 4F11 200 µg, Anti-Cortactin (p80/85) Antibody, clone 4F11 is an antibody against Cortactin (p80/85), and has been published and validated for use in IC, IH, IP and WB. pricing
16-228 Anti-Cortactin (p80/85) Antibody, clone 4F11, Alexa Fluor® 488 100 µg, Detect Cortactin (p80/85) using this Anti-Cortactin (p80/85) Antibody, clone 4F11, Alexa Fluor 488 validated for use in FC, IF, WB & IC. pricing
16-229 Anti-Cortactin (p80/85) Antibody, clone 4F11, Alexa Fluor® 555 100 µg, Anti-Cortactin (p80/85) Antibody, clone 4F11, Alexa Fluor 555 detects level of Cortactin (p80/85) & has been published & validated for use in FC, IF, WB & IC. pricing
05-180-AF647 Anti-Cortactin (p80/85) Antibody, clone 4F11, Alexa Fluor® 647 Conjugate 100 µL, Anti-Cortactin (p80/85) Antibody, clone 4F11, Alexa Fluor® 647 Conjugate is an antibody against Cortactin for use in Immunocytochemistry. pricing
MABT524 Anti-Cortactin (p80/85) Antibody, clone 5G3.2 100 µL, This mouse monoclonal Anti-Cortactin (p80/85), clone 5G3.2 Antibody, Cat. No. MABT524 is validated for use in Western Blotting for the detection of Cortactin. pricing
FCMAB272F Milli-Mark™ Anti-Cortactin (p80/85)-FITC Antibody, clone 4F11 100 tests, Milli-Mark Anti-Cortactin (p80/85)-FITC Antibody, clone 4F11 is an antibody against Cortactin (p80/85) for use in FC. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005231 Rosetta Predictions human pricing
NM_138565 Rosetta Predictions human pricing
NM_021868 Rosetta Predictions rat pricing
NM_007803 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005231 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184662 predicted 419
2 SASI_Hs01_00184663 predicted 1629
3 SASI_Hs01_00184664 predicted 507
4 SASI_Hs01_00184665 predicted 2344
5 SASI_Hs01_00184666 predicted 456
6 SASI_Hs01_00184667 predicted 588
7 SASI_Hs02_00339231 predicted 574
8 SASI_Hs01_00184668 predicted 566
9 SASI_Hs02_00339232 predicted 640
10 SASI_Hs01_00184669 predicted 755
11 SASI_Hs01_00184670 predicted 1573
12 SASI_Hs01_00184671 predicted 2326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138565 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217402 predicted 388
2 SASI_Hs01_00217403 predicted 1484
3 SASI_Hs01_00217405 predicted 472
4 SASI_Hs01_00217406 predicted 2202
5 SASI_Hs01_00217407 predicted 427
6 SASI_Hs01_00217408 predicted 557
7 SASI_Hs02_00363708 predicted 550
8 SASI_Hs01_00217409 predicted 534
9 SASI_Hs02_00363709 predicted 606
10 SASI_Hs01_00217410 predicted 726
11 SASI_Hs01_00217404 predicted 373
12 SASI_Hs01_00217411 predicted 1455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021868 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104307 predicted 978
2 SASI_Rn01_00104308 predicted 430
3 SASI_Rn02_00262900 predicted 700
4 SASI_Rn01_00104309 predicted 730
5 SASI_Rn01_00104310 predicted 1066
6 SASI_Rn01_00104311 predicted 1566
7 SASI_Rn01_00104313 predicted 1709
8 SASI_Rn01_00104314 predicted 793
9 SASI_Rn01_00104315 predicted 1072
10 SASI_Rn01_00104316 predicted 1737
11 SASI_Rn01_00104312 predicted 1340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007803 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193130 predicted 695
2 SASI_Mm01_00193132 predicted 426
3 SASI_Mm01_00193133 predicted 1854
4 SASI_Mm02_00312503 predicted 704
5 SASI_Mm01_00193134 predicted 1093
6 SASI_Mm01_00193135 predicted 808
7 SASI_Mm02_00312504 predicted 1100
8 SASI_Mm02_00312505 predicted 730
9 SASI_Mm02_00312506 predicted 314
10 SASI_Mm02_00312507 predicted 198
11 SASI_Mm01_00193131 predicted 802
12 SASI_Mm01_00193136 predicted 1010
13 SASI_Mm01_00193137 predicted 1529
14 SASI_Mm01_00193138 predicted 1565
15 SASI_Mm01_00193139 predicted 965
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005231
VALIDATED
CTTN MISSION shRNA Bacterial Glycerol Stock
cortactin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005231.2-478s1c1
Sequence:CCGGCACGAATATCAGTCGAAACTTCTCGAGAAGTTTCGACTGATATTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005231.2-1702s1c1
Sequence:CCGGGAGATCTCATTTGACCCTGATCTCGAGATCAGGGTCAAATGAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005231.2-1071s1c1
Sequence:CCGGGCAAGACTACTCCAAAGGATTCTCGAGAATCCTTTGGAGTAGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005231.2-762s1c1
Sequence:CCGGCGGCAAATACGGTATCGACAACTCGAGTTGTCGATACCGTATTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005231.2-627s1c1
Sequence:CCGGGAAAGACTACTCCAGTGGTTTCTCGAGAAACCACTGGAGTAGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005231.3-510s21c1
Sequence:CCGGCACGAATATCAGTCGAAACTTCTCGAGAAGTTTCGACTGATATTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294182    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005231.3-2049s21c1
Sequence:CCGGCCACAGAATTTGCTAATATATCTCGAGATATATTAGCAAATTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005231.3-794s21c1
Sequence:CCGGCGGCAAATACGGTATCGACAACTCGAGTTGTCGATACCGTATTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_005231.3-1103s21c1
Sequence:CCGGGCAAGACTACTCCAAAGGATTCTCGAGAATCCTTTGGAGTAGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_005231.3-1249s21c1
Sequence:CCGGGTAACATCAGAGCTAACTTTGCTCGAGCAAAGTTAGCTCTGATGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005231
VALIDATED
CTTN MISSION shRNA shRNA Plasmid DNA
cortactin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005231.2-478s1c1
Sequence:CCGGCACGAATATCAGTCGAAACTTCTCGAGAAGTTTCGACTGATATTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005231.2-1702s1c1
Sequence:CCGGGAGATCTCATTTGACCCTGATCTCGAGATCAGGGTCAAATGAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005231.2-1071s1c1
Sequence:CCGGGCAAGACTACTCCAAAGGATTCTCGAGAATCCTTTGGAGTAGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005231.2-762s1c1
Sequence:CCGGCGGCAAATACGGTATCGACAACTCGAGTTGTCGATACCGTATTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005231.2-627s1c1
Sequence:CCGGGAAAGACTACTCCAGTGGTTTCTCGAGAAACCACTGGAGTAGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005231.3-510s21c1
Sequence:CCGGCACGAATATCAGTCGAAACTTCTCGAGAAGTTTCGACTGATATTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294182    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005231.3-2049s21c1
Sequence:CCGGCCACAGAATTTGCTAATATATCTCGAGATATATTAGCAAATTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005231.3-794s21c1
Sequence:CCGGCGGCAAATACGGTATCGACAACTCGAGTTGTCGATACCGTATTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_005231.3-1103s21c1
Sequence:CCGGGCAAGACTACTCCAAAGGATTCTCGAGAATCCTTTGGAGTAGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_005231.3-1249s21c1
Sequence:CCGGGTAACATCAGAGCTAACTTTGCTCGAGCAAAGTTAGCTCTGATGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005231
VALIDATED
CTTN MISSION shRNA Lentiviral Transduction Particles
cortactin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005231.2-478s1c1
Sequence:CCGGCACGAATATCAGTCGAAACTTCTCGAGAAGTTTCGACTGATATTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005231.2-1702s1c1
Sequence:CCGGGAGATCTCATTTGACCCTGATCTCGAGATCAGGGTCAAATGAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005231.2-1071s1c1
Sequence:CCGGGCAAGACTACTCCAAAGGATTCTCGAGAATCCTTTGGAGTAGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005231.2-762s1c1
Sequence:CCGGCGGCAAATACGGTATCGACAACTCGAGTTGTCGATACCGTATTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005231.2-627s1c1
Sequence:CCGGGAAAGACTACTCCAGTGGTTTCTCGAGAAACCACTGGAGTAGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005231.3-510s21c1
Sequence:CCGGCACGAATATCAGTCGAAACTTCTCGAGAAGTTTCGACTGATATTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294182    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005231.3-2049s21c1
Sequence:CCGGCCACAGAATTTGCTAATATATCTCGAGATATATTAGCAAATTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005231.3-794s21c1
Sequence:CCGGCGGCAAATACGGTATCGACAACTCGAGTTGTCGATACCGTATTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_005231.3-1103s21c1
Sequence:CCGGGCAAGACTACTCCAAAGGATTCTCGAGAATCCTTTGGAGTAGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_005231.3-1249s21c1
Sequence:CCGGGTAACATCAGAGCTAACTTTGCTCGAGCAAAGTTAGCTCTGATGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007803
VALIDATED
CTTN MISSION shRNA Bacterial Glycerol Stock
cortactin
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007803.1-576s1c1
Sequence:CCGGCCTCCCAGAAAGACTACTCTACTCGAGTAGAGTAGTCTTTCTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007803.1-793s1c1
Sequence:CCGGGCACGAATCCCAGAAAGACTACTCGAGTAGTCTTTCTGGGATTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007803.1-302s1c1
Sequence:CCGGCTTCGAGAGAATGTCTTCCAACTCGAGTTGGAAGACATTCTCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007803.1-1565s1c1
Sequence:CCGGGATGACACCTACGATGGGTATCTCGAGATACCCATCGTAGGTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007803.1-694s1c1
Sequence:CCGGGAAAGATTACTCCAAAGGTTTCTCGAGAAACCTTTGGAGTAATCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007803.4-1582s21c1
Sequence:CCGGGATGACACCTACGATGGGTATCTCGAGATACCCATCGTAGGTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007803.4-711s21c1
Sequence:CCGGGAAAGATTACTCCAAAGGTTTCTCGAGAAACCTTTGGAGTAATCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007803.4-810s21c1
Sequence:CCGGGCACGAATCCCAGAAAGACTACTCGAGTAGTCTTTCTGGGATTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007803.4-319s21c1
Sequence:CCGGCTTCGAGAGAATGTCTTCCAACTCGAGTTGGAAGACATTCTCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007803
VALIDATED
CTTN MISSION shRNA shRNA Plasmid DNA
cortactin
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007803.1-576s1c1
Sequence:CCGGCCTCCCAGAAAGACTACTCTACTCGAGTAGAGTAGTCTTTCTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007803.1-793s1c1
Sequence:CCGGGCACGAATCCCAGAAAGACTACTCGAGTAGTCTTTCTGGGATTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007803.1-302s1c1
Sequence:CCGGCTTCGAGAGAATGTCTTCCAACTCGAGTTGGAAGACATTCTCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007803.1-1565s1c1
Sequence:CCGGGATGACACCTACGATGGGTATCTCGAGATACCCATCGTAGGTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007803.1-694s1c1
Sequence:CCGGGAAAGATTACTCCAAAGGTTTCTCGAGAAACCTTTGGAGTAATCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007803.4-1582s21c1
Sequence:CCGGGATGACACCTACGATGGGTATCTCGAGATACCCATCGTAGGTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007803.4-711s21c1
Sequence:CCGGGAAAGATTACTCCAAAGGTTTCTCGAGAAACCTTTGGAGTAATCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007803.4-810s21c1
Sequence:CCGGGCACGAATCCCAGAAAGACTACTCGAGTAGTCTTTCTGGGATTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007803.4-319s21c1
Sequence:CCGGCTTCGAGAGAATGTCTTCCAACTCGAGTTGGAAGACATTCTCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007803
VALIDATED
CTTN MISSION shRNA Lentiviral Transduction Particles
cortactin
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007803.1-576s1c1
Sequence:CCGGCCTCCCAGAAAGACTACTCTACTCGAGTAGAGTAGTCTTTCTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007803.1-793s1c1
Sequence:CCGGGCACGAATCCCAGAAAGACTACTCGAGTAGTCTTTCTGGGATTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007803.1-302s1c1
Sequence:CCGGCTTCGAGAGAATGTCTTCCAACTCGAGTTGGAAGACATTCTCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007803.1-1565s1c1
Sequence:CCGGGATGACACCTACGATGGGTATCTCGAGATACCCATCGTAGGTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007803.1-694s1c1
Sequence:CCGGGAAAGATTACTCCAAAGGTTTCTCGAGAAACCTTTGGAGTAATCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007803.4-1582s21c1
Sequence:CCGGGATGACACCTACGATGGGTATCTCGAGATACCCATCGTAGGTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007803.4-711s21c1
Sequence:CCGGGAAAGATTACTCCAAAGGTTTCTCGAGAAACCTTTGGAGTAATCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007803.4-810s21c1
Sequence:CCGGGCACGAATCCCAGAAAGACTACTCGAGTAGTCTTTCTGGGATTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007803.4-319s21c1
Sequence:CCGGCTTCGAGAGAATGTCTTCCAACTCGAGTTGGAAGACATTCTCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks