EMAIL THIS PAGE TO A FRIEND

CTTNBP2

cortactin binding protein 2

161 Gene Product Result for
Synonyms: C7orf8 CORTBP2 Orf4
UniProtKB ID: Q8WZ74, O43389, Q7LG11, Q9C0A5
Gene ID:
Human(83992) Summary: This gene encodes a protein with six ankyrin repeats and several proline-rich regions. A similar gene in rat interacts with a central regulator of the actin cytoskeleton. [provided by RefSeq, Jul 2008]
Mouse(30785) cortactin binding protein 2
Rat(282587) cortactin binding protein 2
Zebrafish(555837) cortactin binding protein 2
chicken(417766) cortactin binding protein 2
dog(100687879) cortactin binding protein 2
domestic cat(493673) cortactin binding protein 2
cow(530341) cortactin binding protein 2
cow(493730) cortactin binding protein 2
Horse(100071265) cortactin binding protein 2
domestic guinea pig(100135643) cortactin binding protein 2
domestic guinea pig(100732964) cortactin binding protein 2
naked mole-rat(101722517) cortactin binding protein 2
sheep(100126575) cortactin binding protein 2
Domestic Rabbit(100126566) cortactin binding protein 2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080285 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080285 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080285 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033427 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033427 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033427 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036881 MISSION® esiRNA esiRNA human CTTNBP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033427 Rosetta Predictions human pricing
NM_001114401 Rosetta Predictions rat pricing
NM_080285 Rosetta Predictions mouse pricing
XM_001000629 Rosetta Predictions mouse pricing
XM_289703 Rosetta Predictions mouse pricing
XM_888551 Rosetta Predictions mouse pricing
XM_898128 Rosetta Predictions mouse pricing
XM_898135 Rosetta Predictions mouse pricing
XM_898153 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033427 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361322 predicted 4989
2 SASI_Hs01_00127205 predicted 2453
3 SASI_Hs02_00361323 predicted 1486
4 SASI_Hs01_00127206 predicted 4521
5 SASI_Hs01_00127210 predicted 1413
6 SASI_Hs01_00127211 predicted 3778
7 SASI_Hs02_00361324 predicted 2954
8 SASI_Hs01_00127213 predicted 3481
9 SASI_Hs02_00361325 predicted 788
10 SASI_Hs02_00361326 predicted 1430
11 SASI_Hs01_00127207 predicted 1357
12 SASI_Hs01_00127208 predicted 1535
13 SASI_Hs01_00127209 predicted 4359
14 SASI_Hs01_00127212 predicted 386
15 SASI_Hs01_00127214 predicted 4415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114401 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252243 predicted 2632
2 SASI_Rn02_00252244 predicted 4945
3 SASI_Rn02_00252245 predicted 307
4 SASI_Rn02_00252246 predicted 4162
5 SASI_Rn02_00252247 predicted 3202
6 SASI_Rn02_00252248 predicted 4666
7 SASI_Rn02_00252249 predicted 2451
8 SASI_Rn02_00252250 predicted 1201
9 SASI_Rn02_00252251 predicted 3241
10 SASI_Rn02_00252252 predicted 2067
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080285 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072007 predicted 4937
2 SASI_Mm01_00072008 predicted 4994
3 SASI_Mm01_00072009 predicted 4984
4 SASI_Mm01_00072010 predicted 4659
5 SASI_Mm02_00338079 predicted 1042
6 SASI_Mm01_00072011 predicted 1353
7 SASI_Mm01_00072013 predicted 4505
8 SASI_Mm01_00072014 predicted 293
9 SASI_Mm01_00072015 predicted 2070
10 SASI_Mm01_00072016 predicted 1133
11 SASI_Mm01_00072012 predicted 2450
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000629 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00211787 predicted 4705
2 SASI_Mm01_00211788 predicted 4754
3 SASI_Mm01_00211789 predicted 4333
4 SASI_Mm01_00211790 predicted 4752
5 SASI_Mm01_00211791 predicted 2825
6 SASI_Mm01_00211792 predicted 4424
7 SASI_Mm01_00211793 predicted 2280
8 SASI_Mm01_00211794 predicted 2700
9 SASI_Mm01_00211795 predicted 2216
10 SASI_Mm01_00211796 predicted 2189
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_289703 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00270193 predicted 4869
2 SASI_Mm01_00270194 predicted 4917
3 SASI_Mm01_00270195 predicted 4905
4 SASI_Mm01_00270196 predicted 4590
5 SASI_Mm01_00270197 predicted 1090
6 SASI_Mm01_00270198 predicted 1401
7 SASI_Mm01_00270199 predicted 2377
8 SASI_Mm01_00270200 predicted 4433
9 SASI_Mm01_00270201 predicted 338
10 SASI_Mm01_00270202 predicted 1185
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_888551 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00277628 predicted 4987
2 SASI_Mm01_00277629 predicted 5044
3 SASI_Mm01_00277630 predicted 5030
4 SASI_Mm01_00277631 predicted 4712
5 SASI_Mm01_00277632 predicted 1394
6 SASI_Mm01_00277633 predicted 2501
7 SASI_Mm01_00277634 predicted 4548
8 SASI_Mm01_00277635 predicted 336
9 SASI_Mm01_00277636 predicted 2119
10 SASI_Mm01_00277637 predicted 1176
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898128 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00226427 predicted 417
2 SASI_Mm01_00226428 predicted 421
3 SASI_Mm01_00226429 predicted 312
4 SASI_Mm01_00226430 predicted 409
5 SASI_Mm01_00226431 predicted 385
6 SASI_Mm01_00226432 predicted 385
7 SASI_Mm01_00226433 predicted 413
8 SASI_Mm01_00226434 predicted 384
9 SASI_Mm01_00226435 predicted 247
10 SASI_Mm01_00226436 predicted 269
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898135 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00249614 predicted 1556
2 SASI_Mm01_00249615 predicted 1101
3 SASI_Mm01_00249616 predicted 1089
4 SASI_Mm01_00249617 predicted 1402
5 SASI_Mm01_00249618 predicted 342
6 SASI_Mm01_00249619 predicted 1185
7 SASI_Mm01_00249620 predicted 1253
8 SASI_Mm01_00249621 predicted 1030
9 SASI_Mm01_00249622 predicted 801
10 SASI_Mm01_00249623 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898153 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00248156 predicted 6424
2 SASI_Mm01_00248157 predicted 6472
3 SASI_Mm01_00248158 predicted 6046
4 SASI_Mm01_00248159 predicted 6467
5 SASI_Mm01_00248160 predicted 4530
6 SASI_Mm01_00248161 predicted 6147
7 SASI_Mm01_00248162 predicted 4000
8 SASI_Mm01_00248163 predicted 4423
9 SASI_Mm01_00248164 predicted 3929
10 SASI_Mm01_00248165 predicted 3907
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080285
VALIDATED
CTTNBP2 MISSION shRNA Bacterial Glycerol Stock
cortactin binding protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080285.1-1650s21c1
Sequence:CCGGAGTTGGTCGAACCGGTTTAAACTCGAGTTTAAACCGGTTCGACCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080285.1-306s21c1
Sequence:CCGGGGAACGGTATGGGAGGTTTAACTCGAGTTAAACCTCCCATACCGTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080285.1-5725s21c1
Sequence:CCGGTTGTACCTAAGTGGATATAAACTCGAGTTTATATCCACTTAGGTACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080285.1-2756s21c1
Sequence:CCGGTGGTTCCTGCAGACCTAATTACTCGAGTAATTAGGTCTGCAGGAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080285.1-4856s21c1
Sequence:CCGGTGGGTGTCTCAAGCGTTAAATCTCGAGATTTAACGCTTGAGACACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080285
VALIDATED
CTTNBP2 MISSION shRNA shRNA Plasmid DNA
cortactin binding protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080285.1-1650s21c1
Sequence:CCGGAGTTGGTCGAACCGGTTTAAACTCGAGTTTAAACCGGTTCGACCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080285.1-306s21c1
Sequence:CCGGGGAACGGTATGGGAGGTTTAACTCGAGTTAAACCTCCCATACCGTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080285.1-5725s21c1
Sequence:CCGGTTGTACCTAAGTGGATATAAACTCGAGTTTATATCCACTTAGGTACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080285.1-2756s21c1
Sequence:CCGGTGGTTCCTGCAGACCTAATTACTCGAGTAATTAGGTCTGCAGGAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080285.1-4856s21c1
Sequence:CCGGTGGGTGTCTCAAGCGTTAAATCTCGAGATTTAACGCTTGAGACACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080285
VALIDATED
CTTNBP2 MISSION shRNA Lentiviral Transduction Particles
cortactin binding protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080285.1-1650s21c1
Sequence:CCGGAGTTGGTCGAACCGGTTTAAACTCGAGTTTAAACCGGTTCGACCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080285.1-306s21c1
Sequence:CCGGGGAACGGTATGGGAGGTTTAACTCGAGTTAAACCTCCCATACCGTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080285.1-5725s21c1
Sequence:CCGGTTGTACCTAAGTGGATATAAACTCGAGTTTATATCCACTTAGGTACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080285.1-2756s21c1
Sequence:CCGGTGGTTCCTGCAGACCTAATTACTCGAGTAATTAGGTCTGCAGGAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080285.1-4856s21c1
Sequence:CCGGTGGGTGTCTCAAGCGTTAAATCTCGAGATTTAACGCTTGAGACACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033427
CTTNBP2 MISSION shRNA Bacterial Glycerol Stock
cortactin binding protein 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033427.1-5297s1c1
Sequence:CCGGCCAGGAAGTTATGCCAACTTTCTCGAGAAAGTTGGCATAACTTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033427.1-5712s1c1
Sequence:CCGGGTTTGCATTATGACTCCTGTACTCGAGTACAGGAGTCATAATGCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033427.1-1212s1c1
Sequence:CCGGCCACCTCCAAGTGCAAACAAACTCGAGTTTGTTTGCACTTGGAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033427.1-2729s1c1
Sequence:CCGGCGAGTCAAGTGTCTTTGACTTCTCGAGAAGTCAAAGACACTTGACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033427.1-1096s1c1
Sequence:CCGGCCCTAGTTTCTGCAAATGCAACTCGAGTTGCATTTGCAGAAACTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033427.1-4987s1c1
Sequence:CCGGGCAGCAGTAATACAAGGCAAACTCGAGTTTGCCTTGTATTACTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033427
CTTNBP2 MISSION shRNA shRNA Plasmid DNA
cortactin binding protein 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033427.1-5297s1c1
Sequence:CCGGCCAGGAAGTTATGCCAACTTTCTCGAGAAAGTTGGCATAACTTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033427.1-5712s1c1
Sequence:CCGGGTTTGCATTATGACTCCTGTACTCGAGTACAGGAGTCATAATGCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033427.1-1212s1c1
Sequence:CCGGCCACCTCCAAGTGCAAACAAACTCGAGTTTGTTTGCACTTGGAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033427.1-2729s1c1
Sequence:CCGGCGAGTCAAGTGTCTTTGACTTCTCGAGAAGTCAAAGACACTTGACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033427.1-1096s1c1
Sequence:CCGGCCCTAGTTTCTGCAAATGCAACTCGAGTTGCATTTGCAGAAACTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033427.1-4987s1c1
Sequence:CCGGGCAGCAGTAATACAAGGCAAACTCGAGTTTGCCTTGTATTACTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033427
CTTNBP2 MISSION shRNA Lentiviral Transduction Particles
cortactin binding protein 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033427.1-5297s1c1
Sequence:CCGGCCAGGAAGTTATGCCAACTTTCTCGAGAAAGTTGGCATAACTTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033427.1-5712s1c1
Sequence:CCGGGTTTGCATTATGACTCCTGTACTCGAGTACAGGAGTCATAATGCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033427.1-1212s1c1
Sequence:CCGGCCACCTCCAAGTGCAAACAAACTCGAGTTTGTTTGCACTTGGAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033427.1-2729s1c1
Sequence:CCGGCGAGTCAAGTGTCTTTGACTTCTCGAGAAGTCAAAGACACTTGACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033427.1-1096s1c1
Sequence:CCGGCCCTAGTTTCTGCAAATGCAACTCGAGTTGCATTTGCAGAAACTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033427.1-4987s1c1
Sequence:CCGGGCAGCAGTAATACAAGGCAAACTCGAGTTTGCCTTGTATTACTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)