EMAIL THIS PAGE TO A FRIEND

CTTNBP2NL

CTTNBP2 N-terminal like

241 Gene Product Result for
UniProtKB ID: Q9P2B4, B3KMS5, Q96B40
Gene ID:
Mouse(80281) CTTNBP2 N-terminal like
Rat(310760) CTTNBP2 N-terminal like
sheep(101116359) CTTNBP2 N-terminal like
naked mole-rat(101701290) CTTNBP2 N-terminal like
domestic guinea pig(100714721) CTTNBP2 N-terminal like
Zebrafish(556247) CTTNBP2 N-terminal like
chicken(419870) CTTNBP2 N-terminal like
cow(538981) CTTNBP2 N-terminal like
Horse(100059014) CTTNBP2 N-terminal like
domestic cat(101096001) CTTNBP2 N-terminal like
dog(483222) CTTNBP2 N-terminal like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030249 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030249 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030249 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018704 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018704 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018704 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018704 Rosetta Predictions human pricing
NM_001107712 Rosetta Predictions rat pricing
XM_227556 Rosetta Predictions rat pricing
NM_030249 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185482 predicted 1349
2 SASI_Hs01_00185483 predicted 1078
3 SASI_Hs01_00185484 predicted 790
4 SASI_Hs01_00185485 predicted 2180
5 SASI_Hs01_00185487 predicted 590
6 SASI_Hs01_00185488 predicted 254
7 SASI_Hs01_00185489 predicted 1181
8 SASI_Hs01_00185490 predicted 200
9 SASI_Hs01_00185491 predicted 957
10 SASI_Hs02_00352233 predicted 1780
11 SASI_Hs01_00185486 predicted 1552
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107712 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231525 predicted 277
2 SASI_Rn02_00231526 predicted 761
3 SASI_Rn02_00231527 predicted 1163
4 SASI_Rn02_00231528 predicted 1407
5 SASI_Rn02_00231529 predicted 676
6 SASI_Rn02_00231530 predicted 397
7 SASI_Rn02_00231531 predicted 215
8 SASI_Rn02_00231532 predicted 287
9 SASI_Rn02_00231533 predicted 298
10 SASI_Rn02_00231534 predicted 1204
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227556 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00183723 predicted 299
2 SASI_Rn01_00183724 predicted 966
3 SASI_Rn01_00183725 predicted 783
4 SASI_Rn01_00183726 predicted 1186
5 SASI_Rn01_00183727 predicted 1424
6 SASI_Rn01_00183728 predicted 691
7 SASI_Rn01_00183729 predicted 252
8 SASI_Rn01_00183730 predicted 417
9 SASI_Rn01_00183731 predicted 238
10 SASI_Rn01_00183732 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030249 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106721 predicted 356
2 SASI_Mm01_00106722 predicted 400
3 SASI_Mm01_00106723 predicted 322
4 SASI_Mm01_00106725 predicted 1310
5 SASI_Mm01_00106726 predicted 1829
6 SASI_Mm01_00106727 predicted 544
7 SASI_Mm01_00106728 predicted 1929
8 SASI_Mm02_00336716 predicted 1105
9 SASI_Mm01_00106729 predicted 338
10 SASI_Mm01_00106730 predicted 1453
11 SASI_Mm01_00106724 predicted 457
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030249
VALIDATED
CTTNBP2NL MISSION shRNA Bacterial Glycerol Stock
CTTNBP2 N-terminal like
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030249.2-1314s1c1
Sequence:CCGGCGGCTGCTTACTCATATGCTACTCGAGTAGCATATGAGTAAGCAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030249.2-2175s1c1
Sequence:CCGGGCAAAGATGTTGAGATACTTTCTCGAGAAAGTATCTCAACATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030249.2-726s1c1
Sequence:CCGGCGCAGCAGTTGGAATTTGAAACTCGAGTTTCAAATTCCAACTGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030249.2-365s1c1
Sequence:CCGGGCAAGAGACCTTGTTATAGAACTCGAGTTCTATAACAAGGTCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030249
VALIDATED
CTTNBP2NL MISSION shRNA shRNA Plasmid DNA
CTTNBP2 N-terminal like
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030249.2-1314s1c1
Sequence:CCGGCGGCTGCTTACTCATATGCTACTCGAGTAGCATATGAGTAAGCAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030249.2-2175s1c1
Sequence:CCGGGCAAAGATGTTGAGATACTTTCTCGAGAAAGTATCTCAACATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030249.2-726s1c1
Sequence:CCGGCGCAGCAGTTGGAATTTGAAACTCGAGTTTCAAATTCCAACTGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030249.2-365s1c1
Sequence:CCGGGCAAGAGACCTTGTTATAGAACTCGAGTTCTATAACAAGGTCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030249
VALIDATED
CTTNBP2NL MISSION shRNA Lentiviral Transduction Particles
CTTNBP2 N-terminal like
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030249.2-1314s1c1
Sequence:CCGGCGGCTGCTTACTCATATGCTACTCGAGTAGCATATGAGTAAGCAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030249.2-2175s1c1
Sequence:CCGGGCAAAGATGTTGAGATACTTTCTCGAGAAAGTATCTCAACATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030249.2-726s1c1
Sequence:CCGGCGCAGCAGTTGGAATTTGAAACTCGAGTTTCAAATTCCAACTGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030249.2-365s1c1
Sequence:CCGGGCAAGAGACCTTGTTATAGAACTCGAGTTCTATAACAAGGTCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018704
CTTNBP2NL MISSION shRNA Bacterial Glycerol Stock
CTTNBP2 N-terminal like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018704.1-1752s1c1
Sequence:CCGGCTTTGGCACAGACTATCGAAACTCGAGTTTCGATAGTCTGTGCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167107    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018704.1-2109s1c1
Sequence:CCGGCGTTTGACATTCCATCAGATTCTCGAGAATCTGATGGAATGTCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018704.1-244s1c1
Sequence:CCGGGACCTTGTTATAGAAGCCTTACTCGAGTAAGGCTTCTATAACAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018704.2-1670s21c1
Sequence:CCGGGCCCTCCATCCAGGGATTTATCTCGAGATAAATCCCTGGATGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018704.2-1521s21c1
Sequence:CCGGGGTACTCACTAAGCGTTTATTCTCGAGAATAAACGCTTAGTGAGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018704.2-1243s21c1
Sequence:CCGGGCCACTCCTGCTTACTCATATCTCGAGATATGAGTAAGCAGGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018704.2-4715s21c1
Sequence:CCGGATAACCCAGTTAGGTATTATACTCGAGTATAATACCTAACTGGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018704.2-254s21c1
Sequence:CCGGCTGAACTCCTGACACTATTTACTCGAGTAAATAGTGTCAGGAGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018704
CTTNBP2NL MISSION shRNA shRNA Plasmid DNA
CTTNBP2 N-terminal like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018704.1-1752s1c1
Sequence:CCGGCTTTGGCACAGACTATCGAAACTCGAGTTTCGATAGTCTGTGCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167107    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018704.1-2109s1c1
Sequence:CCGGCGTTTGACATTCCATCAGATTCTCGAGAATCTGATGGAATGTCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018704.1-244s1c1
Sequence:CCGGGACCTTGTTATAGAAGCCTTACTCGAGTAAGGCTTCTATAACAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018704.2-1670s21c1
Sequence:CCGGGCCCTCCATCCAGGGATTTATCTCGAGATAAATCCCTGGATGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018704.2-1521s21c1
Sequence:CCGGGGTACTCACTAAGCGTTTATTCTCGAGAATAAACGCTTAGTGAGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018704.2-1243s21c1
Sequence:CCGGGCCACTCCTGCTTACTCATATCTCGAGATATGAGTAAGCAGGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018704.2-4715s21c1
Sequence:CCGGATAACCCAGTTAGGTATTATACTCGAGTATAATACCTAACTGGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018704.2-254s21c1
Sequence:CCGGCTGAACTCCTGACACTATTTACTCGAGTAAATAGTGTCAGGAGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018704
CTTNBP2NL MISSION shRNA Lentiviral Transduction Particles
CTTNBP2 N-terminal like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018704.1-1752s1c1
Sequence:CCGGCTTTGGCACAGACTATCGAAACTCGAGTTTCGATAGTCTGTGCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167107    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018704.1-2109s1c1
Sequence:CCGGCGTTTGACATTCCATCAGATTCTCGAGAATCTGATGGAATGTCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018704.1-244s1c1
Sequence:CCGGGACCTTGTTATAGAAGCCTTACTCGAGTAAGGCTTCTATAACAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018704.2-1670s21c1
Sequence:CCGGGCCCTCCATCCAGGGATTTATCTCGAGATAAATCCCTGGATGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018704.2-1521s21c1
Sequence:CCGGGGTACTCACTAAGCGTTTATTCTCGAGAATAAACGCTTAGTGAGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018704.2-1243s21c1
Sequence:CCGGGCCACTCCTGCTTACTCATATCTCGAGATATGAGTAAGCAGGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018704.2-4715s21c1
Sequence:CCGGATAACCCAGTTAGGTATTATACTCGAGTATAATACCTAACTGGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018704.2-254s21c1
Sequence:CCGGCTGAACTCCTGACACTATTTACTCGAGTAAATAGTGTCAGGAGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks