EMAIL THIS PAGE TO A FRIEND

CTU1

cytosolic thiouridylase subunit 1

44 Gene Product Result for
Synonyms: ATPBD3 NCS6
UniProtKB ID: Q7Z7A3, A8K558, Q96GZ7
Gene ID:
Mouse(233189) cytosolic thiouridylase subunit 1 homolog (S. pombe)
Rat(292847) cytosolic thiouridylase subunit 1
Zebrafish(393098) cytosolic thiouridylase subunit 1 homolog (S. pombe)
dog(611758) cytosolic thiouridylase subunit 1 homolog (S. pombe)
cow(522824) cytosolic thiouridylase subunit 1 homolog (S. pombe)
domestic guinea pig(100715391) cytosolic thiouridylase subunit 1
naked mole-rat(101704084) cytosolic thiouridylase subunit 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145582 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145582 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145582 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145232 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145232 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145232 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU040991 MISSION® esiRNA esiRNA targeting mouse Atpbd3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145232 Rosetta Predictions human pricing
NM_001106251 Rosetta Predictions rat pricing
NM_145582 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145232 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234101 predicted 346
2 SASI_Hs01_00234102 predicted 245
3 SASI_Hs01_00234103 predicted 238
4 SASI_Hs01_00234104 predicted 273
5 SASI_Hs01_00234105 predicted 238
6 SASI_Hs01_00234106 predicted 260
7 SASI_Hs01_00234107 predicted 246
8 SASI_Hs01_00234108 predicted 266
9 SASI_Hs01_00234109 predicted 243
10 SASI_Hs01_00234110 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106251 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217128 predicted 1531
2 SASI_Rn02_00217129 predicted 588
3 SASI_Rn02_00217130 predicted 1706
4 SASI_Rn02_00217131 predicted 1546
5 SASI_Rn02_00217132 predicted 1597
6 SASI_Rn02_00217133 predicted 1150
7 SASI_Rn02_00217134 predicted 1311
8 SASI_Rn02_00217135 predicted 596
9 SASI_Rn02_00217136 predicted 440
10 SASI_Rn02_00217137 predicted 1533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145582 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031964 predicted 560
2 SASI_Mm01_00031965 predicted 1402
3 SASI_Mm01_00031966 predicted 1394
4 SASI_Mm01_00031967 predicted 1405
5 SASI_Mm01_00031968 predicted 1426
6 SASI_Mm01_00031969 predicted 1505
7 SASI_Mm02_00341117 predicted 1412
8 SASI_Mm01_00031970 predicted 1124
9 SASI_Mm01_00031971 predicted 1650
10 SASI_Mm02_00341118 predicted 1128
11 SASI_Mm01_00031972 predicted 1810
12 SASI_Mm01_00031973 predicted 1129
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145582
VALIDATED
CTU1 MISSION shRNA Bacterial Glycerol Stock
cytosolic thiouridylase subunit 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145582.1-560s21c1
Sequence:CCGGCCTTGTGGGAGCTACACATATCTCGAGATATGTGTAGCTCCCACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145582.1-1128s21c1
Sequence:CCGGTGCAAGCAACCGAAAGATAAACTCGAGTTTATCTTTCGGTTGCTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145582.1-420s21c1
Sequence:CCGGACCATCGTGGCCTACGAAGATCTCGAGATCTTCGTAGGCCACGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145582.1-1343s21c1
Sequence:CCGGACCTGAGCTCTGCACTCTACACTCGAGTGTAGAGTGCAGAGCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145582.1-778s21c1
Sequence:CCGGTTTCCGAGGAGTGCGTGTATGCTCGAGCATACACGCACTCCTCGGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145582.1-1133s1c1
Sequence:CCGGGCAACCGAAAGATAAAGCCAACTCGAGTTGGCTTTATCTTTCGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145582.1-1127s1c1
Sequence:CCGGCTGCAAGCAACCGAAAGATAACTCGAGTTATCTTTCGGTTGCTTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145582.1-1126s1c1
Sequence:CCGGCCTGCAAGCAACCGAAAGATACTCGAGTATCTTTCGGTTGCTTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145582.1-2088s1c1
Sequence:CCGGGCTGAGCTGATAGGTTCTGAACTCGAGTTCAGAACCTATCAGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145582
VALIDATED
CTU1 MISSION shRNA shRNA Plasmid DNA
cytosolic thiouridylase subunit 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145582.1-560s21c1
Sequence:CCGGCCTTGTGGGAGCTACACATATCTCGAGATATGTGTAGCTCCCACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145582.1-1128s21c1
Sequence:CCGGTGCAAGCAACCGAAAGATAAACTCGAGTTTATCTTTCGGTTGCTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145582.1-420s21c1
Sequence:CCGGACCATCGTGGCCTACGAAGATCTCGAGATCTTCGTAGGCCACGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145582.1-1343s21c1
Sequence:CCGGACCTGAGCTCTGCACTCTACACTCGAGTGTAGAGTGCAGAGCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145582.1-778s21c1
Sequence:CCGGTTTCCGAGGAGTGCGTGTATGCTCGAGCATACACGCACTCCTCGGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145582.1-1133s1c1
Sequence:CCGGGCAACCGAAAGATAAAGCCAACTCGAGTTGGCTTTATCTTTCGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145582.1-1127s1c1
Sequence:CCGGCTGCAAGCAACCGAAAGATAACTCGAGTTATCTTTCGGTTGCTTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145582.1-1126s1c1
Sequence:CCGGCCTGCAAGCAACCGAAAGATACTCGAGTATCTTTCGGTTGCTTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145582.1-2088s1c1
Sequence:CCGGGCTGAGCTGATAGGTTCTGAACTCGAGTTCAGAACCTATCAGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145582
VALIDATED
CTU1 MISSION shRNA Lentiviral Transduction Particles
cytosolic thiouridylase subunit 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145582.1-560s21c1
Sequence:CCGGCCTTGTGGGAGCTACACATATCTCGAGATATGTGTAGCTCCCACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145582.1-1128s21c1
Sequence:CCGGTGCAAGCAACCGAAAGATAAACTCGAGTTTATCTTTCGGTTGCTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145582.1-420s21c1
Sequence:CCGGACCATCGTGGCCTACGAAGATCTCGAGATCTTCGTAGGCCACGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145582.1-1343s21c1
Sequence:CCGGACCTGAGCTCTGCACTCTACACTCGAGTGTAGAGTGCAGAGCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145582.1-778s21c1
Sequence:CCGGTTTCCGAGGAGTGCGTGTATGCTCGAGCATACACGCACTCCTCGGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145582.1-1133s1c1
Sequence:CCGGGCAACCGAAAGATAAAGCCAACTCGAGTTGGCTTTATCTTTCGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145582.1-1127s1c1
Sequence:CCGGCTGCAAGCAACCGAAAGATAACTCGAGTTATCTTTCGGTTGCTTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145582.1-1126s1c1
Sequence:CCGGCCTGCAAGCAACCGAAAGATACTCGAGTATCTTTCGGTTGCTTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145582.1-2088s1c1
Sequence:CCGGGCTGAGCTGATAGGTTCTGAACTCGAGTTCAGAACCTATCAGCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145232
CTU1 MISSION shRNA Bacterial Glycerol Stock
cytosolic thiouridylase subunit 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145232.3-412s21c1
Sequence:CCGGTGGCCTACGAAGACCTCTTTGCTCGAGCAAAGAGGTCTTCGTAGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145232.3-1470s21c1
Sequence:CCGGGCTGAACACCGTGTGATTCTTCTCGAGAAGAATCACACGGTGTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145232.3-1566s21c1
Sequence:CCGGCCCTCCTTGAGCATCAGATTCCTCGAGGAATCTGATGCTCAAGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145232.3-762s21c1
Sequence:CCGGTTCTCCGAGGAGTGCGTCTACCTCGAGGTAGACGCACTCCTCGGAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145232.3-561s21c1
Sequence:CCGGCACATCGTGACAGGTCACAACCTCGAGGTTGTGACCTGTCACGATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145232.2-366s1c1
Sequence:CCGGCGTGGCCTACGAAGACCTCTTCTCGAGAAGAGGTCTTCGTAGGCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145232.2-516s1c1
Sequence:CCGGGCACATCGTGACAGGTCACAACTCGAGTTGTGACCTGTCACGATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145232.2-717s1c1
Sequence:CCGGCTTCTCCGAGGAGTGCGTCTACTCGAGTAGACGCACTCCTCGGAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145232.2-201s1c1
Sequence:CCGGCGGCAAGGACTCCACGGTGCTCTCGAGAGCACCGTGGAGTCCTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145232.2-277s1c1
Sequence:CCGGGCCGTCGATGAGGGCATCGGTCTCGAGACCGATGCCCTCATCGACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145232
CTU1 MISSION shRNA shRNA Plasmid DNA
cytosolic thiouridylase subunit 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145232.3-412s21c1
Sequence:CCGGTGGCCTACGAAGACCTCTTTGCTCGAGCAAAGAGGTCTTCGTAGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145232.3-1470s21c1
Sequence:CCGGGCTGAACACCGTGTGATTCTTCTCGAGAAGAATCACACGGTGTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145232.3-1566s21c1
Sequence:CCGGCCCTCCTTGAGCATCAGATTCCTCGAGGAATCTGATGCTCAAGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145232.3-762s21c1
Sequence:CCGGTTCTCCGAGGAGTGCGTCTACCTCGAGGTAGACGCACTCCTCGGAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145232.3-561s21c1
Sequence:CCGGCACATCGTGACAGGTCACAACCTCGAGGTTGTGACCTGTCACGATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145232.2-366s1c1
Sequence:CCGGCGTGGCCTACGAAGACCTCTTCTCGAGAAGAGGTCTTCGTAGGCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145232.2-516s1c1
Sequence:CCGGGCACATCGTGACAGGTCACAACTCGAGTTGTGACCTGTCACGATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145232.2-717s1c1
Sequence:CCGGCTTCTCCGAGGAGTGCGTCTACTCGAGTAGACGCACTCCTCGGAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145232.2-201s1c1
Sequence:CCGGCGGCAAGGACTCCACGGTGCTCTCGAGAGCACCGTGGAGTCCTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145232.2-277s1c1
Sequence:CCGGGCCGTCGATGAGGGCATCGGTCTCGAGACCGATGCCCTCATCGACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145232
CTU1 MISSION shRNA Lentiviral Transduction Particles
cytosolic thiouridylase subunit 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145232.3-412s21c1
Sequence:CCGGTGGCCTACGAAGACCTCTTTGCTCGAGCAAAGAGGTCTTCGTAGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145232.3-1470s21c1
Sequence:CCGGGCTGAACACCGTGTGATTCTTCTCGAGAAGAATCACACGGTGTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145232.3-1566s21c1
Sequence:CCGGCCCTCCTTGAGCATCAGATTCCTCGAGGAATCTGATGCTCAAGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145232.3-762s21c1
Sequence:CCGGTTCTCCGAGGAGTGCGTCTACCTCGAGGTAGACGCACTCCTCGGAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145232.3-561s21c1
Sequence:CCGGCACATCGTGACAGGTCACAACCTCGAGGTTGTGACCTGTCACGATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145232.2-366s1c1
Sequence:CCGGCGTGGCCTACGAAGACCTCTTCTCGAGAAGAGGTCTTCGTAGGCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145232.2-516s1c1
Sequence:CCGGGCACATCGTGACAGGTCACAACTCGAGTTGTGACCTGTCACGATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145232.2-717s1c1
Sequence:CCGGCTTCTCCGAGGAGTGCGTCTACTCGAGTAGACGCACTCCTCGGAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145232.2-201s1c1
Sequence:CCGGCGGCAAGGACTCCACGGTGCTCTCGAGAGCACCGTGGAGTCCTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145232.2-277s1c1
Sequence:CCGGGCCGTCGATGAGGGCATCGGTCTCGAGACCGATGCCCTCATCGACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)