EMAIL THIS PAGE TO A FRIEND

CTU2

cytosolic thiouridylase subunit 2 homolog (S. pombe)

59 Gene Product Result for
Synonyms: C16orf84 NCS2 UPF0432
UniProtKB ID: Q2VPK5, B2RXK0, Q0P511, Q66K78, Q6P4C8, Q86SV4
Gene ID:
Mouse(66965) cytosolic thiouridylase subunit 2 homolog (S. pombe)
Rat(292069) cytosolic thiouridylase subunit 2 homolog (S. pombe)
sheep(101106960) cytosolic thiouridylase subunit 2 homolog (S. pombe)
naked mole-rat(101715059) cytosolic thiouridylase subunit 2 homolog (S. pombe)
domestic guinea pig(100733728) cytosolic thiouridylase subunit 2 homolog (S. pombe)
Zebrafish(445166) cytosolic thiouridylase subunit 2 homolog (S. pombe)
domestic cat(101098183) cytosolic thiouridylase subunit 2 homolog (S. pombe)
cow(614194) cytosolic thiouridylase subunit 2 homolog (S. pombe)
Horse(100049978) cytosolic thiouridylase subunit 2 homolog (S. pombe)
dog(479617) cytosolic thiouridylase subunit 2 homolog (S. pombe)
chicken(415850) cytosolic thiouridylase subunit 2 homolog (S. pombe)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153775 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153775 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153775 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001012762 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012762 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012762 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001012759 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012759 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012759 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012759 Rosetta Predictions human pricing
NM_001012762 Rosetta Predictions human pricing
NM_001037094 Rosetta Predictions rat pricing
NM_153775 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012759 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037699 predicted 412
2 SASI_Hs01_00037700 predicted 360
3 SASI_Hs01_00037701 predicted 475
4 SASI_Hs01_00037702 predicted 1239
5 SASI_Hs01_00037703 predicted 1126
6 SASI_Hs01_00037704 predicted 718
7 SASI_Hs01_00037705 predicted 853
8 SASI_Hs01_00037706 predicted 911
9 SASI_Hs01_00037707 predicted 424
10 SASI_Hs01_00037708 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012762 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103077 predicted 408
2 SASI_Hs01_00103078 predicted 359
3 SASI_Hs01_00103079 predicted 472
4 SASI_Hs01_00103080 predicted 1239
5 SASI_Hs01_00103081 predicted 1126
6 SASI_Hs01_00103082 predicted 721
7 SASI_Hs01_00103083 predicted 857
8 SASI_Hs01_00103084 predicted 913
9 SASI_Hs01_00103085 predicted 420
10 SASI_Hs01_00103086 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037094 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078619 predicted 816
2 SASI_Rn01_00078620 predicted 1095
3 SASI_Rn02_00204225 predicted 434
4 SASI_Rn01_00078621 predicted 938
5 SASI_Rn02_00204226 predicted 691
6 SASI_Rn02_00204227 predicted 209
7 SASI_Rn01_00078622 predicted 1358
8 SASI_Rn01_00078623 predicted 427
9 SASI_Rn01_00078624 predicted 380
10 SASI_Rn01_00078625 predicted 325
11 SASI_Rn01_00078626 predicted 1050
12 SASI_Rn01_00078627 predicted 1189
13 SASI_Rn01_00078628 predicted 833
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153775 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193190 predicted 1394
2 SASI_Mm01_00193192 predicted 321
3 SASI_Mm01_00193193 predicted 1003
4 SASI_Mm01_00193194 predicted 1094
5 SASI_Mm02_00343490 predicted 343
6 SASI_Mm01_00193195 predicted 1000
7 SASI_Mm01_00193196 predicted 1126
8 SASI_Mm01_00193197 predicted 984
9 SASI_Mm01_00193198 predicted 1236
10 SASI_Mm02_00343491 predicted 348
11 SASI_Mm01_00193191 predicted 876
12 SASI_Mm01_00193199 predicted 1155
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153775
VALIDATED
CTU2 MISSION shRNA Bacterial Glycerol Stock
cytosolic thiouridylase subunit 2 homolog (S. pombe)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000177904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153775.1-360s1c1
Sequence:CCGGCCAGGAGTCATCTATGTTGATCTCGAGATCAACATAGATGACTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153775.1-1420s1c1
Sequence:CCGGCAGAGCAGTTATGTTATAGCTCTCGAGAGCTATAACATAACTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153775.1-443s1c1
Sequence:CCGGGATCCTGGAGAACACTGGTTTCTCGAGAAACCAGTGTTCTCCAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153775.1-824s1c1
Sequence:CCGGCCATGGCTATTGCAAGGTAATCTCGAGATTACCTTGCAATAGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153775.1-825s21c1
Sequence:CCGGCATGGCTATTGCAAGGTAATGCTCGAGCATTACCTTGCAATAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153775.1-734s21c1
Sequence:CCGGTAGGTTGTTCAGCTCCATAAACTCGAGTTTATGGAGCTGAACAACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153775.1-1003s1c1
Sequence:CCGGCCTTCTACAACCACCTGTTTACTCGAGTAAACAGGTGGTTGTAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153775.1-355s21c1
Sequence:CCGGTTGTGCCAGGAGTCATCTATGCTCGAGCATAGATGACTCCTGGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153775.1-325s21c1
Sequence:CCGGTGAGTCAGGATTCTGCGAAACCTCGAGGTTTCGCAGAATCCTGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153775
VALIDATED
CTU2 MISSION shRNA shRNA Plasmid DNA
cytosolic thiouridylase subunit 2 homolog (S. pombe)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000177904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153775.1-360s1c1
Sequence:CCGGCCAGGAGTCATCTATGTTGATCTCGAGATCAACATAGATGACTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153775.1-1420s1c1
Sequence:CCGGCAGAGCAGTTATGTTATAGCTCTCGAGAGCTATAACATAACTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153775.1-443s1c1
Sequence:CCGGGATCCTGGAGAACACTGGTTTCTCGAGAAACCAGTGTTCTCCAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153775.1-824s1c1
Sequence:CCGGCCATGGCTATTGCAAGGTAATCTCGAGATTACCTTGCAATAGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153775.1-825s21c1
Sequence:CCGGCATGGCTATTGCAAGGTAATGCTCGAGCATTACCTTGCAATAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153775.1-734s21c1
Sequence:CCGGTAGGTTGTTCAGCTCCATAAACTCGAGTTTATGGAGCTGAACAACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153775.1-1003s1c1
Sequence:CCGGCCTTCTACAACCACCTGTTTACTCGAGTAAACAGGTGGTTGTAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153775.1-355s21c1
Sequence:CCGGTTGTGCCAGGAGTCATCTATGCTCGAGCATAGATGACTCCTGGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153775.1-325s21c1
Sequence:CCGGTGAGTCAGGATTCTGCGAAACCTCGAGGTTTCGCAGAATCCTGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153775
VALIDATED
CTU2 MISSION shRNA Lentiviral Transduction Particles
cytosolic thiouridylase subunit 2 homolog (S. pombe)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000177904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153775.1-360s1c1
Sequence:CCGGCCAGGAGTCATCTATGTTGATCTCGAGATCAACATAGATGACTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153775.1-1420s1c1
Sequence:CCGGCAGAGCAGTTATGTTATAGCTCTCGAGAGCTATAACATAACTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153775.1-443s1c1
Sequence:CCGGGATCCTGGAGAACACTGGTTTCTCGAGAAACCAGTGTTCTCCAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153775.1-824s1c1
Sequence:CCGGCCATGGCTATTGCAAGGTAATCTCGAGATTACCTTGCAATAGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153775.1-825s21c1
Sequence:CCGGCATGGCTATTGCAAGGTAATGCTCGAGCATTACCTTGCAATAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153775.1-734s21c1
Sequence:CCGGTAGGTTGTTCAGCTCCATAAACTCGAGTTTATGGAGCTGAACAACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153775.1-1003s1c1
Sequence:CCGGCCTTCTACAACCACCTGTTTACTCGAGTAAACAGGTGGTTGTAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153775.1-355s21c1
Sequence:CCGGTTGTGCCAGGAGTCATCTATGCTCGAGCATAGATGACTCCTGGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153775.1-325s21c1
Sequence:CCGGTGAGTCAGGATTCTGCGAAACCTCGAGGTTTCGCAGAATCCTGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012762
VALIDATED
CTU2 MISSION shRNA Bacterial Glycerol Stock
cytosolic thiouridylase subunit 2 homolog (S. pombe)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012762.1-453s1c1
Sequence:CCGGCATTCTGCAAGCAACTGGGTTCTCGAGAACCCAGTTGCTTGCAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012762.1-1146s1c1
Sequence:CCGGGACAAGTGAGAAGCTGGTGAACTCGAGTTCACCAGCTTCTCACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001012762.1-1140s1c1
Sequence:CCGGGTACAGGACAAGTGAGAAGCTCTCGAGAGCTTCTCACTTGTCCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001012762.1-1018s1c1
Sequence:CCGGGTTCCTTCTGTCTTCACACCACTCGAGTGGTGTGAAGACAGAAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001012762.1-123s1c1
Sequence:CCGGGCAGAAGTGTGTGAAGTGCAACTCGAGTTGCACTTCACACACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012762.1-334s1c1
Sequence:CCGGCTGAGCCAAGATTCTGCCAAACTCGAGTTTGGCAGAATCTTGGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012762.1-857s1c1
Sequence:CCGGGCTTGGCTATCAAGCTCATGACTCGAGTCATGAGCTTGATAGCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012762.1-126s1c1
Sequence:CCGGGAAGTGTGTGAAGTGCAAGGACTCGAGTCCTTGCACTTCACACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012762.1-1018s21c1
Sequence:CCGGGTTCCTTCTGTCTTCACACCACTCGAGTGGTGTGAAGACAGAAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001012762.1-126s21c1
Sequence:CCGGGAAGTGTGTGAAGTGCAAGGACTCGAGTCCTTGCACTTCACACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012762.1-365s21c1
Sequence:CCGGTTGTGGCAGGAGTCATCTTTGCTCGAGCAAAGATGACTCCTGCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_001012762.1-412s21c1
Sequence:CCGGAGCCTAGAGGAGAGATCAAAGCTCGAGCTTTGATCTCTCCTCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012762.1-981s21c1
Sequence:CCGGCCTGAAGGAGGTCGCTTTCTACTCGAGTAGAAAGCGACCTCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012762
VALIDATED
CTU2 MISSION shRNA shRNA Plasmid DNA
cytosolic thiouridylase subunit 2 homolog (S. pombe)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012762.1-453s1c1
Sequence:CCGGCATTCTGCAAGCAACTGGGTTCTCGAGAACCCAGTTGCTTGCAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012762.1-1146s1c1
Sequence:CCGGGACAAGTGAGAAGCTGGTGAACTCGAGTTCACCAGCTTCTCACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001012762.1-1140s1c1
Sequence:CCGGGTACAGGACAAGTGAGAAGCTCTCGAGAGCTTCTCACTTGTCCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001012762.1-1018s1c1
Sequence:CCGGGTTCCTTCTGTCTTCACACCACTCGAGTGGTGTGAAGACAGAAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001012762.1-123s1c1
Sequence:CCGGGCAGAAGTGTGTGAAGTGCAACTCGAGTTGCACTTCACACACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012762.1-334s1c1
Sequence:CCGGCTGAGCCAAGATTCTGCCAAACTCGAGTTTGGCAGAATCTTGGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012762.1-857s1c1
Sequence:CCGGGCTTGGCTATCAAGCTCATGACTCGAGTCATGAGCTTGATAGCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012762.1-126s1c1
Sequence:CCGGGAAGTGTGTGAAGTGCAAGGACTCGAGTCCTTGCACTTCACACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012762.1-1018s21c1
Sequence:CCGGGTTCCTTCTGTCTTCACACCACTCGAGTGGTGTGAAGACAGAAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001012762.1-126s21c1
Sequence:CCGGGAAGTGTGTGAAGTGCAAGGACTCGAGTCCTTGCACTTCACACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012762.1-365s21c1
Sequence:CCGGTTGTGGCAGGAGTCATCTTTGCTCGAGCAAAGATGACTCCTGCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_001012762.1-412s21c1
Sequence:CCGGAGCCTAGAGGAGAGATCAAAGCTCGAGCTTTGATCTCTCCTCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012762.1-981s21c1
Sequence:CCGGCCTGAAGGAGGTCGCTTTCTACTCGAGTAGAAAGCGACCTCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012762
VALIDATED
CTU2 MISSION shRNA Lentiviral Transduction Particles
cytosolic thiouridylase subunit 2 homolog (S. pombe)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012762.1-453s1c1
Sequence:CCGGCATTCTGCAAGCAACTGGGTTCTCGAGAACCCAGTTGCTTGCAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012762.1-1146s1c1
Sequence:CCGGGACAAGTGAGAAGCTGGTGAACTCGAGTTCACCAGCTTCTCACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001012762.1-1140s1c1
Sequence:CCGGGTACAGGACAAGTGAGAAGCTCTCGAGAGCTTCTCACTTGTCCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001012762.1-1018s1c1
Sequence:CCGGGTTCCTTCTGTCTTCACACCACTCGAGTGGTGTGAAGACAGAAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001012762.1-123s1c1
Sequence:CCGGGCAGAAGTGTGTGAAGTGCAACTCGAGTTGCACTTCACACACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012762.1-334s1c1
Sequence:CCGGCTGAGCCAAGATTCTGCCAAACTCGAGTTTGGCAGAATCTTGGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012762.1-857s1c1
Sequence:CCGGGCTTGGCTATCAAGCTCATGACTCGAGTCATGAGCTTGATAGCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012762.1-126s1c1
Sequence:CCGGGAAGTGTGTGAAGTGCAAGGACTCGAGTCCTTGCACTTCACACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012762.1-1018s21c1
Sequence:CCGGGTTCCTTCTGTCTTCACACCACTCGAGTGGTGTGAAGACAGAAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001012762.1-126s21c1
Sequence:CCGGGAAGTGTGTGAAGTGCAAGGACTCGAGTCCTTGCACTTCACACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012762.1-365s21c1
Sequence:CCGGTTGTGGCAGGAGTCATCTTTGCTCGAGCAAAGATGACTCCTGCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_001012762.1-412s21c1
Sequence:CCGGAGCCTAGAGGAGAGATCAAAGCTCGAGCTTTGATCTCTCCTCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012762.1-981s21c1
Sequence:CCGGCCTGAAGGAGGTCGCTTTCTACTCGAGTAGAAAGCGACCTCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012759
CTU2 MISSION shRNA Bacterial Glycerol Stock
cytosolic thiouridylase subunit 2 homolog (S. pombe)
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000165908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012759.1-119s1c1
Sequence:CCGGGTGAGCAGAAGTGTGTGAAGTCTCGAGACTTCACACACTTCTGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012759
CTU2 MISSION shRNA shRNA Plasmid DNA
cytosolic thiouridylase subunit 2 homolog (S. pombe)
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000165908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012759.1-119s1c1
Sequence:CCGGGTGAGCAGAAGTGTGTGAAGTCTCGAGACTTCACACACTTCTGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012759
CTU2 MISSION shRNA Lentiviral Transduction Particles
cytosolic thiouridylase subunit 2 homolog (S. pombe)
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000165908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012759.1-119s1c1
Sequence:CCGGGTGAGCAGAAGTGTGTGAAGTCTCGAGACTTCACACACTTCTGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks