EMAIL THIS PAGE TO A FRIEND

CTXN1

cortexin 1

44 Gene Product Result for
Synonyms: CTXN
UniProtKB ID: P60606
Gene ID:
Mouse(330695) cortexin 1
Rat(29145) cortexin 1
chicken(420051) cortexin 1
cow(100125924) cortexin 1
dog(611574) cortexin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA016669 Anti-CTXN1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_206833 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_206833 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_206833 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183315 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183315 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183315 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU051451 MISSION® esiRNA esiRNA targeting mouse Ctxn1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_206833 Rosetta Predictions human pricing
NM_001109935 Rosetta Predictions rat pricing
NM_183315 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206833 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244729 predicted 783
2 SASI_Hs01_00244730 predicted 788
3 SASI_Hs01_00244725 predicted 871
4 SASI_Hs02_00373561 predicted 781
5 SASI_Hs01_00244728 predicted 850
6 SASI_Hs02_00373562 predicted 795
7 SASI_Hs02_00373563 predicted 780
8 SASI_Hs02_00373564 predicted 803
9 SASI_Hs01_00244731 predicted 736
10 SASI_Hs01_00244732 predicted 309
11 SASI_Hs01_00244724 predicted 936
12 SASI_Hs01_00244726 predicted 928
13 SASI_Hs01_00244727 predicted 933
14 SASI_Hs01_00244733 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109935 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250892 predicted 862
2 SASI_Rn02_00250893 predicted 915
3 SASI_Rn02_00250894 predicted 372
4 SASI_Rn02_00250895 predicted 615
5 SASI_Rn02_00250896 predicted 715
6 SASI_Rn02_00250897 predicted 548
7 SASI_Rn02_00250898 predicted 440
8 SASI_Rn02_00250899 predicted 728
9 SASI_Rn02_00250900 predicted 314
10 SASI_Rn02_00250901 predicted 812
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183315 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044933 predicted 973
2 SASI_Mm01_00044934 predicted 853
3 SASI_Mm01_00044935 predicted 460
4 SASI_Mm01_00044936 predicted 729
5 SASI_Mm01_00044937 predicted 923
6 SASI_Mm01_00044938 predicted 600
7 SASI_Mm01_00044939 predicted 780
8 SASI_Mm02_00350441 predicted 690
9 SASI_Mm01_00044940 predicted 600
10 SASI_Mm01_00044941 predicted 939
11 SASI_Mm01_00044942 predicted 919
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_206833
CTXN1 MISSION shRNA Bacterial Glycerol Stock
cortexin 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206833.3-950s21c1
Sequence:CCGGGCGGACGCTGCATACCAATTTCTCGAGAAATTGGTATGCAGCGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206833.3-877s21c1
Sequence:CCGGCCCACCTTGACTGAGTGTTGACTCGAGTCAACACTCAGTCAAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206833.3-449s21c1
Sequence:CCGGTTCGACTACGCGTTGGTGTGACTCGAGTCACACCAACGCGTAGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244032    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206833.3-790s21c1
Sequence:CCGGCGTGTAAGTGGCTCTGCTATTCTCGAGAATAGCAGAGCCACTTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206833.3-855s21c1
Sequence:CCGGCTGTTGTCTGGCCGTCGTCAACTCGAGTTGACGACGGCCAGACAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_206833
CTXN1 MISSION shRNA shRNA Plasmid DNA
cortexin 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206833.3-950s21c1
Sequence:CCGGGCGGACGCTGCATACCAATTTCTCGAGAAATTGGTATGCAGCGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206833.3-877s21c1
Sequence:CCGGCCCACCTTGACTGAGTGTTGACTCGAGTCAACACTCAGTCAAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206833.3-449s21c1
Sequence:CCGGTTCGACTACGCGTTGGTGTGACTCGAGTCACACCAACGCGTAGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244032    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206833.3-790s21c1
Sequence:CCGGCGTGTAAGTGGCTCTGCTATTCTCGAGAATAGCAGAGCCACTTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206833.3-855s21c1
Sequence:CCGGCTGTTGTCTGGCCGTCGTCAACTCGAGTTGACGACGGCCAGACAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_206833
CTXN1 MISSION shRNA Lentiviral Transduction Particles
cortexin 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206833.3-950s21c1
Sequence:CCGGGCGGACGCTGCATACCAATTTCTCGAGAAATTGGTATGCAGCGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206833.3-877s21c1
Sequence:CCGGCCCACCTTGACTGAGTGTTGACTCGAGTCAACACTCAGTCAAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206833.3-449s21c1
Sequence:CCGGTTCGACTACGCGTTGGTGTGACTCGAGTCACACCAACGCGTAGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244032    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206833.3-790s21c1
Sequence:CCGGCGTGTAAGTGGCTCTGCTATTCTCGAGAATAGCAGAGCCACTTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206833.3-855s21c1
Sequence:CCGGCTGTTGTCTGGCCGTCGTCAACTCGAGTTGACGACGGCCAGACAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183315
VALIDATED
CTXN1 MISSION shRNA Bacterial Glycerol Stock
cortexin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183315.1-405s1c1
Sequence:CCGGAGTTCGACTATGCGTTGGTGTCTCGAGACACCAACGCATAGTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183315.1-305s1c1
Sequence:CCGGGTTCTGTTGATGGTGCGCTGTCTCGAGACAGCGCACCATCAACAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125134    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183315.1-732s1c1
Sequence:CCGGGCTACATTCTTTCCTGGAAATCTCGAGATTTCCAGGAAAGAATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183315.1-377s1c1
Sequence:CCGGGACCACAAGGAGGCGCTCGAACTCGAGTTCGAGCGCCTCCTTGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183315.1-253s1c1
Sequence:CCGGCGTCGAGCAACGCACGGTGTTCTCGAGAACACCGTGCGTTGCTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183315
VALIDATED
CTXN1 MISSION shRNA shRNA Plasmid DNA
cortexin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183315.1-405s1c1
Sequence:CCGGAGTTCGACTATGCGTTGGTGTCTCGAGACACCAACGCATAGTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183315.1-305s1c1
Sequence:CCGGGTTCTGTTGATGGTGCGCTGTCTCGAGACAGCGCACCATCAACAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125134    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183315.1-732s1c1
Sequence:CCGGGCTACATTCTTTCCTGGAAATCTCGAGATTTCCAGGAAAGAATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183315.1-377s1c1
Sequence:CCGGGACCACAAGGAGGCGCTCGAACTCGAGTTCGAGCGCCTCCTTGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183315.1-253s1c1
Sequence:CCGGCGTCGAGCAACGCACGGTGTTCTCGAGAACACCGTGCGTTGCTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183315
VALIDATED
CTXN1 MISSION shRNA Lentiviral Transduction Particles
cortexin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183315.1-405s1c1
Sequence:CCGGAGTTCGACTATGCGTTGGTGTCTCGAGACACCAACGCATAGTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183315.1-305s1c1
Sequence:CCGGGTTCTGTTGATGGTGCGCTGTCTCGAGACAGCGCACCATCAACAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125134    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183315.1-732s1c1
Sequence:CCGGGCTACATTCTTTCCTGGAAATCTCGAGATTTCCAGGAAAGAATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183315.1-377s1c1
Sequence:CCGGGACCACAAGGAGGCGCTCGAACTCGAGTTCGAGCGCCTCCTTGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183315.1-253s1c1
Sequence:CCGGCGTCGAGCAACGCACGGTGTTCTCGAGAACACCGTGCGTTGCTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks