EMAIL THIS PAGE TO A FRIEND

CTXN3

cortexin 3

136 Gene Product Result for
Synonyms: KABE
UniProtKB ID: Q4LDR2, B2RV32, D3DQ82
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001048252 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001048252 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001048252 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001048252 Rosetta Predictions human pricing
NM_001127385 Rosetta Predictions human pricing
XM_928386 Rosetta Predictions human pricing
XM_932841 Rosetta Predictions human pricing
NM_001134696 Rosetta Predictions rat pricing
XM_001477678 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048252 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311832 predicted 1009
2 SASI_Hs02_00311833 predicted 1010
3 SASI_Hs02_00311834 predicted 1201
4 SASI_Hs02_00311835 predicted 1193
5 SASI_Hs02_00311836 predicted 978
6 SASI_Hs02_00311837 predicted 1085
7 SASI_Hs02_00311838 predicted 1280
8 SASI_Hs02_00311839 predicted 858
9 SASI_Hs02_00311840 predicted 1208
10 SASI_Hs02_00311841 predicted 888
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127385 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329334 predicted 821
2 SASI_Hs02_00329335 predicted 823
3 SASI_Hs02_00329336 predicted 1019
4 SASI_Hs02_00329337 predicted 1010
5 SASI_Hs02_00329338 predicted 787
6 SASI_Hs02_00329339 predicted 893
7 SASI_Hs02_00329340 predicted 1092
8 SASI_Hs02_00329341 predicted 662
9 SASI_Hs02_00329342 predicted 1017
10 SASI_Hs02_00329343 predicted 705
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928386 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00292370 predicted 984
2 SASI_Hs01_00292371 predicted 992
3 SASI_Hs01_00292372 predicted 1185
4 SASI_Hs01_00292373 predicted 865
5 SASI_Hs01_00292374 predicted 955
6 SASI_Hs01_00292375 predicted 1062
7 SASI_Hs01_00292376 predicted 1253
8 SASI_Hs01_00292377 predicted 834
9 SASI_Hs01_00292378 predicted 1179
10 SASI_Hs01_00292379 predicted 865
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932841 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00284303 predicted 783
2 SASI_Hs01_00284304 predicted 789
3 SASI_Hs01_00284305 predicted 981
4 SASI_Hs01_00284306 predicted 656
5 SASI_Hs01_00284307 predicted 758
6 SASI_Hs01_00284308 predicted 868
7 SASI_Hs01_00284309 predicted 1056
8 SASI_Hs01_00284310 predicted 631
9 SASI_Hs01_00284311 predicted 979
10 SASI_Hs01_00284312 predicted 661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134696 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257989 predicted 1095
2 SASI_Rn02_00257990 predicted 978
3 SASI_Rn02_00257991 predicted 949
4 SASI_Rn02_00257992 predicted 958
5 SASI_Rn02_00257993 predicted 879
6 SASI_Rn02_00257994 predicted 1219
7 SASI_Rn02_00257995 predicted 720
8 SASI_Rn02_00257996 predicted 661
9 SASI_Rn02_00257997 predicted 1020
10 SASI_Rn02_00257998 predicted 1059
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001477678 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00397458 predicted 87
2 SASI_Mm02_00397459 predicted 39
3 SASI_Mm02_00397460 predicted 129
4 SASI_Mm02_00397461 predicted 135
5 SASI_Mm02_00397462 predicted 138
6 SASI_Mm02_00397463 predicted 37
7 SASI_Mm02_00397464 predicted 156
8 SASI_Mm02_00397465 predicted 160
9 SASI_Mm02_00397466 predicted 44
10 SASI_Mm02_00397467 predicted 176
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001048252
CTXN3 MISSION shRNA Bacterial Glycerol Stock
cortexin 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048252.2-760s21c1
Sequence:CCGGTACCTGGGCTGATGGACTTGACTCGAGTCAAGTCCATCAGCCCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048252.2-731s21c1
Sequence:CCGGTTGGATCCATATCGAAGCATGCTCGAGCATGCTTCGATATGGATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048252.2-1081s21c1
Sequence:CCGGGTGAAACCAAGAGCGTTAATACTCGAGTATTAACGCTCTTGGTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048252.2-800s21c1
Sequence:CCGGTTCGACCATGCCCTTGCTTAGCTCGAGCTAAGCAAGGGCATGGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048252.2-774s21c1
Sequence:CCGGGACTTGAAGGCCTGGAGAAAGCTCGAGCTTTCTCCAGGCCTTCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048252.2-625s21c1
Sequence:CCGGATCAGCAGATTCTAGCATGTCCTCGAGGACATGCTAGAATCTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048252.2-701s21c1
Sequence:CCGGATTCTCATTGTCCGGTGCTTCCTCGAGGAAGCACCGGACAATGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371057    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048252.2-1156s21c1
Sequence:CCGGAGACTAGAAAGGATCTCATATCTCGAGATATGAGATCCTTTCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001048252
CTXN3 MISSION shRNA shRNA Plasmid DNA
cortexin 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048252.2-760s21c1
Sequence:CCGGTACCTGGGCTGATGGACTTGACTCGAGTCAAGTCCATCAGCCCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048252.2-731s21c1
Sequence:CCGGTTGGATCCATATCGAAGCATGCTCGAGCATGCTTCGATATGGATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048252.2-1081s21c1
Sequence:CCGGGTGAAACCAAGAGCGTTAATACTCGAGTATTAACGCTCTTGGTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048252.2-800s21c1
Sequence:CCGGTTCGACCATGCCCTTGCTTAGCTCGAGCTAAGCAAGGGCATGGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048252.2-774s21c1
Sequence:CCGGGACTTGAAGGCCTGGAGAAAGCTCGAGCTTTCTCCAGGCCTTCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048252.2-625s21c1
Sequence:CCGGATCAGCAGATTCTAGCATGTCCTCGAGGACATGCTAGAATCTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048252.2-701s21c1
Sequence:CCGGATTCTCATTGTCCGGTGCTTCCTCGAGGAAGCACCGGACAATGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371057    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048252.2-1156s21c1
Sequence:CCGGAGACTAGAAAGGATCTCATATCTCGAGATATGAGATCCTTTCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001048252
CTXN3 MISSION shRNA Lentiviral Transduction Particles
cortexin 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048252.2-760s21c1
Sequence:CCGGTACCTGGGCTGATGGACTTGACTCGAGTCAAGTCCATCAGCCCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048252.2-731s21c1
Sequence:CCGGTTGGATCCATATCGAAGCATGCTCGAGCATGCTTCGATATGGATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048252.2-1081s21c1
Sequence:CCGGGTGAAACCAAGAGCGTTAATACTCGAGTATTAACGCTCTTGGTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048252.2-800s21c1
Sequence:CCGGTTCGACCATGCCCTTGCTTAGCTCGAGCTAAGCAAGGGCATGGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048252.2-774s21c1
Sequence:CCGGGACTTGAAGGCCTGGAGAAAGCTCGAGCTTTCTCCAGGCCTTCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048252.2-625s21c1
Sequence:CCGGATCAGCAGATTCTAGCATGTCCTCGAGGACATGCTAGAATCTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048252.2-701s21c1
Sequence:CCGGATTCTCATTGTCCGGTGCTTCCTCGAGGAAGCACCGGACAATGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371057    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048252.2-1156s21c1
Sequence:CCGGAGACTAGAAAGGATCTCATATCTCGAGATATGAGATCCTTTCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks