EMAIL THIS PAGE TO A FRIEND

CUBN

cubilin (intrinsic factor-cobalamin receptor)

67 Gene Product Result for
Synonyms: IFCR MGA1 gp280
UniProtKB ID: O60494, B0YIZ4, Q5VTA6, Q96RU9
Gene ID:
Human(8029) Summary: Cubilin (CUBN) acts as a receptor for intrinsic factor-vitamin B12 complexes. The role of receptor is supported by the presence of 27 CUB domains. Cubulin is located within the epithelium of intestine and kidney. Mutations in CUBN may play a role in autosomal recessive megaloblastic anemia. [provided by RefSeq, Jul 2008]
Mouse(65969) cubilin (intrinsic factor-cobalamin receptor)
Rat(80848) cubilin (intrinsic factor-cobalamin receptor)
Zebrafish(100144772) cubilin (intrinsic factor-cobalamin receptor)
domestic cat(101091458) cubilin (intrinsic factor-cobalamin receptor)
cow(523202) cubilin (intrinsic factor-cobalamin receptor)
dog(403767) cubilin (intrinsic factor-cobalamin receptor)
chicken(420523) cubilin (intrinsic factor-cobalamin receptor)
sheep(101110433) cubilin (intrinsic factor-cobalamin receptor)
naked mole-rat(101720941) cubilin (intrinsic factor-cobalamin receptor)
domestic guinea pig(100724712) cubilin (intrinsic factor-cobalamin receptor)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301904 Anti-CUBN affinity isolated antibody human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081084 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081084 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081084 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001081 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001081 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001081 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001081 Rosetta Predictions human pricing
NM_053332 Rosetta Predictions rat pricing
NM_001081084 Rosetta Predictions mouse pricing
XM_130038 Rosetta Predictions mouse pricing
XM_899184 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090002 predicted 9741
2 SASI_Hs01_00090003 predicted 2758
3 SASI_Hs01_00090004 predicted 943
4 SASI_Hs02_00316280 predicted 3287
5 SASI_Hs01_00090005 predicted 3918
6 SASI_Hs01_00090006 predicted 6285
7 SASI_Hs02_00316281 predicted 8106
8 SASI_Hs01_00090007 predicted 5778
9 SASI_Hs01_00090008 predicted 4754
10 SASI_Hs02_00316282 predicted 7804
11 SASI_Hs01_00090000 predicted 10363
12 SASI_Hs01_00090001 predicted 9169
13 SASI_Hs01_00090009 predicted 2926
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053332 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066678 predicted 10194
2 SASI_Rn01_00066679 predicted 2807
3 SASI_Rn02_00265791 predicted 4583
4 SASI_Rn02_00265792 predicted 2511
5 SASI_Rn01_00066680 predicted 7747
6 SASI_Rn01_00066681 predicted 5179
7 SASI_Rn02_00265793 predicted 8353
8 SASI_Rn01_00066683 predicted 5476
9 SASI_Rn01_00066685 predicted 8107
10 SASI_Rn01_00066686 predicted 6778
11 SASI_Rn01_00066682 predicted 2397
12 SASI_Rn01_00066684 predicted 1787
13 SASI_Rn01_00066687 predicted 5660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081084 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295021 predicted 8382
2 SASI_Mm02_00295022 predicted 6767
3 SASI_Mm02_00295023 predicted 7250
4 SASI_Mm02_00295024 predicted 8993
5 SASI_Mm02_00295025 predicted 2568
6 SASI_Mm02_00295026 predicted 4288
7 SASI_Mm02_00295027 predicted 1836
8 SASI_Mm02_00295028 predicted 8412
9 SASI_Mm02_00295029 predicted 5717
10 SASI_Mm02_00295030 predicted 3033
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_130038 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00278648 predicted 4414
2 SASI_Mm01_00278649 predicted 8389
3 SASI_Mm01_00278650 predicted 6763
4 SASI_Mm01_00278651 predicted 7256
5 SASI_Mm01_00278652 predicted 8997
6 SASI_Mm01_00278653 predicted 2577
7 SASI_Mm01_00278654 predicted 5212
8 SASI_Mm01_00278655 predicted 8423
9 SASI_Mm01_00278656 predicted 9286
10 SASI_Mm01_00278657 predicted 2463
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899184 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00269888 predicted 1087
2 SASI_Mm01_00269889 predicted 831
3 SASI_Mm01_00269890 predicted 1808
4 SASI_Mm01_00269891 predicted 1688
5 SASI_Mm01_00269892 predicted 1115
6 SASI_Mm01_00269893 predicted 1894
7 SASI_Mm01_00269894 predicted 2961
8 SASI_Mm01_00269895 predicted 1296
9 SASI_Mm01_00269896 predicted 1987
10 SASI_Mm01_00269897 predicted 871
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081084
VALIDATED
CUBN MISSION shRNA Bacterial Glycerol Stock
cubilin (intrinsic factor-cobalamin receptor)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081084.2-4509s21c1
Sequence:CCGGTGAACTAGCAATCCGATTTAACTCGAGTTAAATCGGATTGCTAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081084.2-7516s21c1
Sequence:CCGGCACGAAGGAAGGCAGATTATCCTCGAGGATAATCTGCCTTCCTTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081084.2-1836s21c1
Sequence:CCGGCGGCATACTGACTGGTAATTACTCGAGTAATTACCAGTCAGTATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081084.2-11159s21c1
Sequence:CCGGTCCTTACTGGATGCACCATTTCTCGAGAAATGGTGCATCCAGTAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081084.2-7831s21c1
Sequence:CCGGATCCGTGATTACGCGAGAAATCTCGAGATTTCTCGCGTAATCACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081084
VALIDATED
CUBN MISSION shRNA shRNA Plasmid DNA
cubilin (intrinsic factor-cobalamin receptor)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081084.2-4509s21c1
Sequence:CCGGTGAACTAGCAATCCGATTTAACTCGAGTTAAATCGGATTGCTAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081084.2-7516s21c1
Sequence:CCGGCACGAAGGAAGGCAGATTATCCTCGAGGATAATCTGCCTTCCTTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081084.2-1836s21c1
Sequence:CCGGCGGCATACTGACTGGTAATTACTCGAGTAATTACCAGTCAGTATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081084.2-11159s21c1
Sequence:CCGGTCCTTACTGGATGCACCATTTCTCGAGAAATGGTGCATCCAGTAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081084.2-7831s21c1
Sequence:CCGGATCCGTGATTACGCGAGAAATCTCGAGATTTCTCGCGTAATCACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081084
VALIDATED
CUBN MISSION shRNA Lentiviral Transduction Particles
cubilin (intrinsic factor-cobalamin receptor)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081084.2-4509s21c1
Sequence:CCGGTGAACTAGCAATCCGATTTAACTCGAGTTAAATCGGATTGCTAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081084.2-7516s21c1
Sequence:CCGGCACGAAGGAAGGCAGATTATCCTCGAGGATAATCTGCCTTCCTTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081084.2-1836s21c1
Sequence:CCGGCGGCATACTGACTGGTAATTACTCGAGTAATTACCAGTCAGTATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081084.2-11159s21c1
Sequence:CCGGTCCTTACTGGATGCACCATTTCTCGAGAAATGGTGCATCCAGTAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081084.2-7831s21c1
Sequence:CCGGATCCGTGATTACGCGAGAAATCTCGAGATTTCTCGCGTAATCACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081
CUBN MISSION shRNA Bacterial Glycerol Stock
cubilin (intrinsic factor-cobalamin receptor)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001081.2-4938s1c1
Sequence:CCGGCCTGCCAATTATCCAAACAATCTCGAGATTGTTTGGATAATTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001081.2-3625s1c1
Sequence:CCGGGCAGCGCATTTGAACTGGAATCTCGAGATTCCAGTTCAAATGCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001081.2-2248s1c1
Sequence:CCGGCCCAGGGAGAACAAATACAAACTCGAGTTTGTATTTGTTCTCCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001081.2-8917s1c1
Sequence:CCGGCCTTCCACTTAGAAGCTCGTTCTCGAGAACGAGCTTCTAAGTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001081.2-1702s1c1
Sequence:CCGGGCAGTGACAATGCTCTCTATTCTCGAGAATAGAGAGCATTGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081
CUBN MISSION shRNA shRNA Plasmid DNA
cubilin (intrinsic factor-cobalamin receptor)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001081.2-4938s1c1
Sequence:CCGGCCTGCCAATTATCCAAACAATCTCGAGATTGTTTGGATAATTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001081.2-3625s1c1
Sequence:CCGGGCAGCGCATTTGAACTGGAATCTCGAGATTCCAGTTCAAATGCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001081.2-2248s1c1
Sequence:CCGGCCCAGGGAGAACAAATACAAACTCGAGTTTGTATTTGTTCTCCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001081.2-8917s1c1
Sequence:CCGGCCTTCCACTTAGAAGCTCGTTCTCGAGAACGAGCTTCTAAGTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001081.2-1702s1c1
Sequence:CCGGGCAGTGACAATGCTCTCTATTCTCGAGAATAGAGAGCATTGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081
CUBN MISSION shRNA Lentiviral Transduction Particles
cubilin (intrinsic factor-cobalamin receptor)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001081.2-4938s1c1
Sequence:CCGGCCTGCCAATTATCCAAACAATCTCGAGATTGTTTGGATAATTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001081.2-3625s1c1
Sequence:CCGGGCAGCGCATTTGAACTGGAATCTCGAGATTCCAGTTCAAATGCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001081.2-2248s1c1
Sequence:CCGGCCCAGGGAGAACAAATACAAACTCGAGTTTGTATTTGTTCTCCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001081.2-8917s1c1
Sequence:CCGGCCTTCCACTTAGAAGCTCGTTCTCGAGAACGAGCTTCTAAGTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001081.2-1702s1c1
Sequence:CCGGGCAGTGACAATGCTCTCTATTCTCGAGAATAGAGAGCATTGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks