EMAIL THIS PAGE TO A FRIEND

CUEDC1

CUE domain containing 1

UniProtKB ID: Q9NWM3, D3DTZ2, Q9NWD0
Gene ID:
Mouse(103841) CUE domain containing 1
Rat(303419) CUE domain containing 1
chicken(417665) CUE domain containing 1
cow(534625) CUE domain containing 1
dog(491105) CUE domain containing 1
domestic cat(101100262) CUE domain containing 1
domestic guinea pig(100722527) CUE domain containing 1
naked mole-rat(101714440) CUE domain containing 1
sheep(101120504) CUE domain containing 1
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017949 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017949 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017949 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198013 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198013 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198013 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU046491 MISSION® esiRNA esiRNA targeting mouse Cuedc1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017949 Rosetta Predictions human pricing
NM_001013971 Rosetta Predictions rat pricing
NM_198013 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017949 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017164 predicted 1249
2 SASI_Hs01_00017165 predicted 1766
3 SASI_Hs01_00017166 predicted 1120
4 SASI_Hs01_00017167 predicted 1497
5 SASI_Hs01_00017168 predicted 1254
6 SASI_Hs01_00017170 predicted 1719
7 SASI_Hs01_00017171 predicted 1116
8 SASI_Hs01_00017172 predicted 1289
9 SASI_Hs01_00017173 predicted 1176
10 SASI_Hs02_00350969 predicted 1483
11 SASI_Hs01_00017169 predicted 1872
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013971 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096613 predicted 1267
2 SASI_Rn01_00096614 predicted 898
3 SASI_Rn01_00096616 predicted 598
4 SASI_Rn01_00096617 predicted 900
5 SASI_Rn02_00201298 predicted 905
6 SASI_Rn01_00096619 predicted 1614
7 SASI_Rn01_00096620 predicted 766
8 SASI_Rn01_00096621 predicted 972
9 SASI_Rn01_00096622 predicted 1280
10 SASI_Rn02_00201299 predicted 533
11 SASI_Rn01_00096615 predicted 1223
12 SASI_Rn01_00096618 predicted 1139
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198013 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350726 predicted 1104
2 SASI_Mm01_00060717 predicted 1059
3 SASI_Mm01_00060718 predicted 543
4 SASI_Mm01_00060719 predicted 968
5 SASI_Mm01_00060720 predicted 702
6 SASI_Mm01_00060721 predicted 708
7 SASI_Mm01_00060722 predicted 1208
8 SASI_Mm01_00060723 predicted 1218
9 SASI_Mm01_00060725 predicted 462
10 SASI_Mm01_00060726 predicted 632
11 SASI_Mm01_00060724 predicted 1653
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017949
VALIDATED
CUEDC1 MISSION shRNA Bacterial Glycerol Stock
CUE domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007697    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017949.1-1904s1c1
Sequence:CCGGCCAGAGATGATCTGACCCGGTCTCGAGACCGGGTCAGATCATCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017949.1-869s1c1
Sequence:CCGGCATGGACGACTTCAAGACCATCTCGAGATGGTCTTGAAGTCGTCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017949.1-1551s1c1
Sequence:CCGGGTCGGAAACGACTTTGGCTTTCTCGAGAAAGCCAAAGTCGTTTCCGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017949.1-1608s1c1
Sequence:CCGGGCTGTGTCTGAAGATGCCTTACTCGAGTAAGGCATCTTCAGACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017949.1-1074s1c1
Sequence:CCGGGAACCTGATAGCTCGGATGAACTCGAGTTCATCCGAGCTATCAGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_017949.1-1053s21c1
Sequence:CCGGGAGATCTTGGAAAGGACTTTGCTCGAGCAAAGTCCTTTCCAAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_017949.1-1608s21c1
Sequence:CCGGGCTGTGTCTGAAGATGCCTTACTCGAGTAAGGCATCTTCAGACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_017949.1-1516s21c1
Sequence:CCGGACGAATCCCAGAAATCTAAATCTCGAGATTTAGATTTCTGGGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_017949.1-1546s21c1
Sequence:CCGGTGGCTGTCGGAAACGACTTTGCTCGAGCAAAGTCGTTTCCGACAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017949.1-1255s21c1
Sequence:CCGGGCAACCTTCCGGATGACTTTCCTCGAGGAAAGTCATCCGGAAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017949
VALIDATED
CUEDC1 MISSION shRNA shRNA Plasmid DNA
CUE domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007697    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017949.1-1904s1c1
Sequence:CCGGCCAGAGATGATCTGACCCGGTCTCGAGACCGGGTCAGATCATCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017949.1-869s1c1
Sequence:CCGGCATGGACGACTTCAAGACCATCTCGAGATGGTCTTGAAGTCGTCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017949.1-1551s1c1
Sequence:CCGGGTCGGAAACGACTTTGGCTTTCTCGAGAAAGCCAAAGTCGTTTCCGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017949.1-1608s1c1
Sequence:CCGGGCTGTGTCTGAAGATGCCTTACTCGAGTAAGGCATCTTCAGACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017949.1-1074s1c1
Sequence:CCGGGAACCTGATAGCTCGGATGAACTCGAGTTCATCCGAGCTATCAGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_017949.1-1053s21c1
Sequence:CCGGGAGATCTTGGAAAGGACTTTGCTCGAGCAAAGTCCTTTCCAAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_017949.1-1608s21c1
Sequence:CCGGGCTGTGTCTGAAGATGCCTTACTCGAGTAAGGCATCTTCAGACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_017949.1-1516s21c1
Sequence:CCGGACGAATCCCAGAAATCTAAATCTCGAGATTTAGATTTCTGGGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_017949.1-1546s21c1
Sequence:CCGGTGGCTGTCGGAAACGACTTTGCTCGAGCAAAGTCGTTTCCGACAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017949.1-1255s21c1
Sequence:CCGGGCAACCTTCCGGATGACTTTCCTCGAGGAAAGTCATCCGGAAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017949
VALIDATED
CUEDC1 MISSION shRNA Lentiviral Transduction Particles
CUE domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007697    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017949.1-1904s1c1
Sequence:CCGGCCAGAGATGATCTGACCCGGTCTCGAGACCGGGTCAGATCATCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017949.1-869s1c1
Sequence:CCGGCATGGACGACTTCAAGACCATCTCGAGATGGTCTTGAAGTCGTCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017949.1-1551s1c1
Sequence:CCGGGTCGGAAACGACTTTGGCTTTCTCGAGAAAGCCAAAGTCGTTTCCGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017949.1-1608s1c1
Sequence:CCGGGCTGTGTCTGAAGATGCCTTACTCGAGTAAGGCATCTTCAGACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017949.1-1074s1c1
Sequence:CCGGGAACCTGATAGCTCGGATGAACTCGAGTTCATCCGAGCTATCAGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_017949.1-1053s21c1
Sequence:CCGGGAGATCTTGGAAAGGACTTTGCTCGAGCAAAGTCCTTTCCAAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_017949.1-1608s21c1
Sequence:CCGGGCTGTGTCTGAAGATGCCTTACTCGAGTAAGGCATCTTCAGACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_017949.1-1516s21c1
Sequence:CCGGACGAATCCCAGAAATCTAAATCTCGAGATTTAGATTTCTGGGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_017949.1-1546s21c1
Sequence:CCGGTGGCTGTCGGAAACGACTTTGCTCGAGCAAAGTCGTTTCCGACAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017949.1-1255s21c1
Sequence:CCGGGCAACCTTCCGGATGACTTTCCTCGAGGAAAGTCATCCGGAAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198013
CUEDC1 MISSION shRNA Bacterial Glycerol Stock
CUE domain containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198013.1-573s1c1
Sequence:CCGGCAAGACTATGTTTCCTAACATCTCGAGATGTTAGGAAACATAGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190711    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198013.1-1722s1c1
Sequence:CCGGGCTTTCCACAGACAGGACTTACTCGAGTAAGTCCTGTCTGTGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191150    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198013.1-1746s1c1
Sequence:CCGGCTTTCAGAGCTGCTTATGATTCTCGAGAATCATAAGCAGCTCTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198013.2-494s21c1
Sequence:CCGGACATGGACTACGACATCATTGCTCGAGCAATGATGTCGTAGTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198013.2-1085s21c1
Sequence:CCGGTGGAGAGAGACCGATTGAAATCTCGAGATTTCAATCGGTCTCTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198013.2-466s21c1
Sequence:CCGGATGGACGACTTCAAGACTATGCTCGAGCATAGTCTTGAAGTCGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198013.2-1578s21c1
Sequence:CCGGACCAAGGCTCAGGCTTCTTCACTCGAGTGAAGAAGCCTGAGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198013.2-1201s21c1
Sequence:CCGGGTGTCAGAAGATGCCTTATTCCTCGAGGAATAAGGCATCTTCTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198013
CUEDC1 MISSION shRNA shRNA Plasmid DNA
CUE domain containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198013.1-573s1c1
Sequence:CCGGCAAGACTATGTTTCCTAACATCTCGAGATGTTAGGAAACATAGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190711    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198013.1-1722s1c1
Sequence:CCGGGCTTTCCACAGACAGGACTTACTCGAGTAAGTCCTGTCTGTGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191150    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198013.1-1746s1c1
Sequence:CCGGCTTTCAGAGCTGCTTATGATTCTCGAGAATCATAAGCAGCTCTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198013.2-494s21c1
Sequence:CCGGACATGGACTACGACATCATTGCTCGAGCAATGATGTCGTAGTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198013.2-1085s21c1
Sequence:CCGGTGGAGAGAGACCGATTGAAATCTCGAGATTTCAATCGGTCTCTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198013.2-466s21c1
Sequence:CCGGATGGACGACTTCAAGACTATGCTCGAGCATAGTCTTGAAGTCGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198013.2-1578s21c1
Sequence:CCGGACCAAGGCTCAGGCTTCTTCACTCGAGTGAAGAAGCCTGAGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198013.2-1201s21c1
Sequence:CCGGGTGTCAGAAGATGCCTTATTCCTCGAGGAATAAGGCATCTTCTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198013
CUEDC1 MISSION shRNA Lentiviral Transduction Particles
CUE domain containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198013.1-573s1c1
Sequence:CCGGCAAGACTATGTTTCCTAACATCTCGAGATGTTAGGAAACATAGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190711    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198013.1-1722s1c1
Sequence:CCGGGCTTTCCACAGACAGGACTTACTCGAGTAAGTCCTGTCTGTGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191150    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198013.1-1746s1c1
Sequence:CCGGCTTTCAGAGCTGCTTATGATTCTCGAGAATCATAAGCAGCTCTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198013.2-494s21c1
Sequence:CCGGACATGGACTACGACATCATTGCTCGAGCAATGATGTCGTAGTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198013.2-1085s21c1
Sequence:CCGGTGGAGAGAGACCGATTGAAATCTCGAGATTTCAATCGGTCTCTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198013.2-466s21c1
Sequence:CCGGATGGACGACTTCAAGACTATGCTCGAGCATAGTCTTGAAGTCGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198013.2-1578s21c1
Sequence:CCGGACCAAGGCTCAGGCTTCTTCACTCGAGTGAAGAAGCCTGAGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198013.2-1201s21c1
Sequence:CCGGGTGTCAGAAGATGCCTTATTCCTCGAGGAATAAGGCATCTTCTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks