EMAIL THIS PAGE TO A FRIEND

CUEDC2

CUE domain containing 2

71 Gene Product Result for
Synonyms: C10orf66 bA18I14.5
UniProtKB ID: Q9H467, D3DR88, Q9BWG8
Gene ID:
Mouse(67116) CUE domain containing 2
Rat(294009) CUE domain containing 2
Zebrafish(334351) CUE domain containing 2
cow(516091) CUE domain containing 2
domestic cat(101081332) CUE domain containing 2
dog(486861) CUE domain containing 2
chicken(423761) CUE domain containing 2
sheep(101107917) CUE domain containing 2
naked mole-rat(101719221) CUE domain containing 2
domestic guinea pig(100735764) CUE domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024040 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024040 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024040 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024192 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024192 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024192 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055071 MISSION® esiRNA esiRNA human CUEDC2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024040 Rosetta Predictions human pricing
NM_001079886 Rosetta Predictions rat pricing
NM_024192 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024040 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093358 predicted 316
2 SASI_Hs01_00093359 predicted 683
3 SASI_Hs01_00093361 predicted 382
4 SASI_Hs01_00093362 predicted 873
5 SASI_Hs02_00356465 predicted 493
6 SASI_Hs02_00356466 predicted 223
7 SASI_Hs01_00093365 predicted 408
8 SASI_Hs02_00356467 predicted 826
9 SASI_Hs01_00093367 predicted 427
10 SASI_Hs02_00356468 predicted 923
11 SASI_Hs01_00093360 predicted 893
12 SASI_Hs01_00093363 predicted 759
13 SASI_Hs01_00093364 predicted 747
14 SASI_Hs01_00093366 predicted 745
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079886 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208169 predicted 809
2 SASI_Rn02_00208170 predicted 1224
3 SASI_Rn02_00208171 predicted 1259
4 SASI_Rn02_00208172 predicted 1019
5 SASI_Rn02_00208173 predicted 1258
6 SASI_Rn02_00208174 predicted 935
7 SASI_Rn02_00208175 predicted 1088
8 SASI_Rn02_00208176 predicted 949
9 SASI_Rn02_00208177 predicted 1026
10 SASI_Rn02_00208178 predicted 1162
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024192 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139757 predicted 691
2 SASI_Mm01_00139758 predicted 329
3 SASI_Mm01_00139759 predicted 379
4 SASI_Mm01_00139761 predicted 231
5 SASI_Mm01_00139762 predicted 589
6 SASI_Mm01_00139763 predicted 304
7 SASI_Mm01_00139765 predicted 576
8 SASI_Mm02_00327523 predicted 783
9 SASI_Mm01_00139766 predicted 425
10 SASI_Mm02_00327524 predicted 391
11 SASI_Mm01_00139760 predicted 918
12 SASI_Mm01_00139764 predicted 889
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024040
VALIDATED
CUEDC2 MISSION shRNA Bacterial Glycerol Stock
CUE domain containing 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024040.2-957s21c1
Sequence:CCGGAGGAGATGAAGGCCACATACACTCGAGTGTATGTGGCCTTCATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024040.2-227s21c1
Sequence:CCGGGGCTTGGATGAGGTCATCTTCCTCGAGGAAGATGACCTCATCCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024040.2-293s21c1
Sequence:CCGGTCAGAGGAGAACTTCGATATGCTCGAGCATATCGAAGTTCTCCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024040.2-820s21c1
Sequence:CCGGGGATAGCGCAGAGGATCAGAACTCGAGTTCTGATCCTCTGCGCTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024040.2-900s21c1
Sequence:CCGGACCAGGTAGTGAGCACCAAAGCTCGAGCTTTGGTGCTCACTACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024040.2-411s21c1
Sequence:CCGGTGAGCGATGCCAGGAACAAAGCTCGAGCTTTGTTCCTGGCATCGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138480    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024040.1-923s1c1
Sequence:CCGGCCAGAAAGTACCGCTTCCATTCTCGAGAATGGAAGCGGTACTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024040.1-804s1c1
Sequence:CCGGCAAGAAGCTGATCCGATACATCTCGAGATGTATCGGATCAGCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024040.1-231s1c1
Sequence:CCGGGAACTTCGATATGGAGGCTTTCTCGAGAAAGCCTCCATATCGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024040.1-717s1c1
Sequence:CCGGGAAGTCCTTCATCCTGCAGAACTCGAGTTCTGCAGGATGAAGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024040.1-855s1c1
Sequence:CCGGGCGATTCAAAGATGTGCGGAACTCGAGTTCCGCACATCTTTGAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024040.1-313s1c1
Sequence:CCGGGACATGATGCAGAAGCTCTCACTCGAGTGAGAGCTTCTGCATCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024040
VALIDATED
CUEDC2 MISSION shRNA shRNA Plasmid DNA
CUE domain containing 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024040.2-957s21c1
Sequence:CCGGAGGAGATGAAGGCCACATACACTCGAGTGTATGTGGCCTTCATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024040.2-227s21c1
Sequence:CCGGGGCTTGGATGAGGTCATCTTCCTCGAGGAAGATGACCTCATCCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024040.2-293s21c1
Sequence:CCGGTCAGAGGAGAACTTCGATATGCTCGAGCATATCGAAGTTCTCCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024040.2-820s21c1
Sequence:CCGGGGATAGCGCAGAGGATCAGAACTCGAGTTCTGATCCTCTGCGCTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024040.2-900s21c1
Sequence:CCGGACCAGGTAGTGAGCACCAAAGCTCGAGCTTTGGTGCTCACTACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024040.2-411s21c1
Sequence:CCGGTGAGCGATGCCAGGAACAAAGCTCGAGCTTTGTTCCTGGCATCGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138480    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024040.1-923s1c1
Sequence:CCGGCCAGAAAGTACCGCTTCCATTCTCGAGAATGGAAGCGGTACTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024040.1-804s1c1
Sequence:CCGGCAAGAAGCTGATCCGATACATCTCGAGATGTATCGGATCAGCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024040.1-231s1c1
Sequence:CCGGGAACTTCGATATGGAGGCTTTCTCGAGAAAGCCTCCATATCGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024040.1-717s1c1
Sequence:CCGGGAAGTCCTTCATCCTGCAGAACTCGAGTTCTGCAGGATGAAGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024040.1-855s1c1
Sequence:CCGGGCGATTCAAAGATGTGCGGAACTCGAGTTCCGCACATCTTTGAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024040.1-313s1c1
Sequence:CCGGGACATGATGCAGAAGCTCTCACTCGAGTGAGAGCTTCTGCATCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024040
VALIDATED
CUEDC2 MISSION shRNA Lentiviral Transduction Particles
CUE domain containing 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024040.2-957s21c1
Sequence:CCGGAGGAGATGAAGGCCACATACACTCGAGTGTATGTGGCCTTCATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024040.2-227s21c1
Sequence:CCGGGGCTTGGATGAGGTCATCTTCCTCGAGGAAGATGACCTCATCCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024040.2-293s21c1
Sequence:CCGGTCAGAGGAGAACTTCGATATGCTCGAGCATATCGAAGTTCTCCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024040.2-820s21c1
Sequence:CCGGGGATAGCGCAGAGGATCAGAACTCGAGTTCTGATCCTCTGCGCTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024040.2-900s21c1
Sequence:CCGGACCAGGTAGTGAGCACCAAAGCTCGAGCTTTGGTGCTCACTACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024040.2-411s21c1
Sequence:CCGGTGAGCGATGCCAGGAACAAAGCTCGAGCTTTGTTCCTGGCATCGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138480    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024040.1-923s1c1
Sequence:CCGGCCAGAAAGTACCGCTTCCATTCTCGAGAATGGAAGCGGTACTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024040.1-804s1c1
Sequence:CCGGCAAGAAGCTGATCCGATACATCTCGAGATGTATCGGATCAGCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024040.1-231s1c1
Sequence:CCGGGAACTTCGATATGGAGGCTTTCTCGAGAAAGCCTCCATATCGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024040.1-717s1c1
Sequence:CCGGGAAGTCCTTCATCCTGCAGAACTCGAGTTCTGCAGGATGAAGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024040.1-855s1c1
Sequence:CCGGGCGATTCAAAGATGTGCGGAACTCGAGTTCCGCACATCTTTGAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024040.1-313s1c1
Sequence:CCGGGACATGATGCAGAAGCTCTCACTCGAGTGAGAGCTTCTGCATCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024192
VALIDATED
CUEDC2 MISSION shRNA Bacterial Glycerol Stock
CUE domain containing 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024192.1-879s1c1
Sequence:CCGGCAAGAAGCTGATCCGATACATCTCGAGATGTATCGGATCAGCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024192.1-425s21c1
Sequence:CCGGTGAGCGATGCTAGGAACAAAGCTCGAGCTTTGTTCCTAGCATCGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024192.1-879s21c1
Sequence:CCGGCAAGAAGCTGATCCGATACATCTCGAGATGTATCGGATCAGCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024192.1-920s21c1
Sequence:CCGGCCAAGGGAGAGCGATTCAAAGCTCGAGCTTTGAATCGCTCTCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024192.1-302s21c1
Sequence:CCGGGACCATCAGAGGAGAACTTTGCTCGAGCAAAGTTCTCCTCTGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024192.1-337s21c1
Sequence:CCGGACTGAAATGATGGAGGCTTATCTCGAGATAAGCCTCCATCATTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024192.1-424s1c1
Sequence:CCGGCTGAGCGATGCTAGGAACAAACTCGAGTTTGTTCCTAGCATCGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024192.1-804s1c1
Sequence:CCGGCCTTCAGAAGTACATGATGGTCTCGAGACCATCATGTACTTCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024192.1-381s1c1
Sequence:CCGGCAGAGGTATAATAGGAGACATCTCGAGATGTCTCCTATTATACCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024192
VALIDATED
CUEDC2 MISSION shRNA shRNA Plasmid DNA
CUE domain containing 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024192.1-879s1c1
Sequence:CCGGCAAGAAGCTGATCCGATACATCTCGAGATGTATCGGATCAGCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024192.1-425s21c1
Sequence:CCGGTGAGCGATGCTAGGAACAAAGCTCGAGCTTTGTTCCTAGCATCGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024192.1-879s21c1
Sequence:CCGGCAAGAAGCTGATCCGATACATCTCGAGATGTATCGGATCAGCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024192.1-920s21c1
Sequence:CCGGCCAAGGGAGAGCGATTCAAAGCTCGAGCTTTGAATCGCTCTCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024192.1-302s21c1
Sequence:CCGGGACCATCAGAGGAGAACTTTGCTCGAGCAAAGTTCTCCTCTGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024192.1-337s21c1
Sequence:CCGGACTGAAATGATGGAGGCTTATCTCGAGATAAGCCTCCATCATTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024192.1-424s1c1
Sequence:CCGGCTGAGCGATGCTAGGAACAAACTCGAGTTTGTTCCTAGCATCGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024192.1-804s1c1
Sequence:CCGGCCTTCAGAAGTACATGATGGTCTCGAGACCATCATGTACTTCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024192.1-381s1c1
Sequence:CCGGCAGAGGTATAATAGGAGACATCTCGAGATGTCTCCTATTATACCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024192
VALIDATED
CUEDC2 MISSION shRNA Lentiviral Transduction Particles
CUE domain containing 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024192.1-879s1c1
Sequence:CCGGCAAGAAGCTGATCCGATACATCTCGAGATGTATCGGATCAGCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024192.1-425s21c1
Sequence:CCGGTGAGCGATGCTAGGAACAAAGCTCGAGCTTTGTTCCTAGCATCGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024192.1-879s21c1
Sequence:CCGGCAAGAAGCTGATCCGATACATCTCGAGATGTATCGGATCAGCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024192.1-920s21c1
Sequence:CCGGCCAAGGGAGAGCGATTCAAAGCTCGAGCTTTGAATCGCTCTCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024192.1-302s21c1
Sequence:CCGGGACCATCAGAGGAGAACTTTGCTCGAGCAAAGTTCTCCTCTGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024192.1-337s21c1
Sequence:CCGGACTGAAATGATGGAGGCTTATCTCGAGATAAGCCTCCATCATTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024192.1-424s1c1
Sequence:CCGGCTGAGCGATGCTAGGAACAAACTCGAGTTTGTTCCTAGCATCGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024192.1-804s1c1
Sequence:CCGGCCTTCAGAAGTACATGATGGTCTCGAGACCATCATGTACTTCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024192.1-381s1c1
Sequence:CCGGCAGAGGTATAATAGGAGACATCTCGAGATGTCTCCTATTATACCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks