EMAIL THIS PAGE TO A FRIEND
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV03049 Anti-CUL1 antibody produced in rabbit IgG fraction of antiserum bovine, zebrafish, mouse, canine, rat, human
western blot pricing
SAB1411513 Anti-CUL1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA064584 Anti-CUL1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4503365 Anti-Cullin 1, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
C7117 Anti-Cullin-1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
western blot pricing
PLA0277 Rabbit anti-Cul1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. rabbit, human, guinea pig, bovine, dog, chicken, turkey, toad, horse, mouse, rat, zebrafish, toad
immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003592 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003592 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003592 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_012042 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012042 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012042 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003592 Rosetta Predictions human pricing
NM_001108627 Rosetta Predictions rat pricing
NM_012042 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003592 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335921 predicted 664
2 SASI_Hs01_00021744 predicted 2332
3 SASI_Hs01_00021745 predicted 603
4 SASI_Hs01_00021746 predicted 1188
5 SASI_Hs01_00021748 predicted 1613
6 SASI_Hs02_00335922 predicted 1809
7 SASI_Hs01_00021750 predicted 2173
8 SASI_Hs01_00021751 predicted 1707
9 SASI_Hs01_00021752 predicted 1682
10 SASI_Hs01_00021753 predicted 1296
11 SASI_Hs01_00021747 predicted 2672
12 SASI_Hs01_00021749 predicted 1312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108627 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240489 predicted 1798
2 SASI_Rn02_00240490 predicted 692
3 SASI_Rn02_00240491 predicted 2563
4 SASI_Rn02_00240492 predicted 2377
5 SASI_Rn02_00240493 predicted 2232
6 SASI_Rn02_00240494 predicted 886
7 SASI_Rn02_00240495 predicted 1208
8 SASI_Rn02_00240496 predicted 1197
9 SASI_Rn02_00240497 predicted 618
10 SASI_Rn02_00240498 predicted 2242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012042 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322009 predicted 423
2 SASI_Mm01_00112832 predicted 2632
3 SASI_Mm01_00112833 predicted 1776
4 SASI_Mm01_00112834 predicted 1847
5 SASI_Mm01_00112835 predicted 959
6 SASI_Mm01_00112837 predicted 2141
7 SASI_Mm01_00112838 predicted 2251
8 SASI_Mm01_00112839 predicted 1789
9 SASI_Mm01_00112840 predicted 834
10 SASI_Mm02_00322010 predicted 2317
11 SASI_Mm01_00112836 predicted 1287
12 SASI_Mm01_00112841 predicted 688
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003592
VALIDATED
CUL1 MISSION shRNA Bacterial Glycerol Stock
cullin 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003592.x-1195s1c1
Sequence:CCGGGCACACAAGATGAATTAGCAACTCGAGTTGCTAATTCATCTTGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003592.x-1806s1c1
Sequence:CCGGGCCAGCATGATCTCCAAGTTACTCGAGTAACTTGGAGATCATGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003592.x-675s1c1
Sequence:CCGGGATTTGATGGATGAGAGTGTACTCGAGTACACTCTCATCCATCAAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003592.x-2089s1c1
Sequence:CCGGCGTGGTTATATCAGTTGTCTACTCGAGTAGACAACTGATATAACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003592.x-2709s1c1
Sequence:CCGGCCCGCAGCAAATAGTTCATGTCTCGAGACATGAACTATTTGCTGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_003592.2-1195s21c1
Sequence:CCGGGCACACAAGATGAATTAGCAACTCGAGTTGCTAATTCATCTTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318416    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003592.2-2709s21c1
Sequence:CCGGCCCGCAGCAAATAGTTCATGTCTCGAGACATGAACTATTTGCTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_003592.2-2089s21c1
Sequence:CCGGCGTGGTTATATCAGTTGTCTACTCGAGTAGACAACTGATATAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003592.2-1806s21c1
Sequence:CCGGGCCAGCATGATCTCCAAGTTACTCGAGTAACTTGGAGATCATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003592
VALIDATED
CUL1 MISSION shRNA shRNA Plasmid DNA
cullin 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003592.x-1195s1c1
Sequence:CCGGGCACACAAGATGAATTAGCAACTCGAGTTGCTAATTCATCTTGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003592.x-1806s1c1
Sequence:CCGGGCCAGCATGATCTCCAAGTTACTCGAGTAACTTGGAGATCATGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003592.x-675s1c1
Sequence:CCGGGATTTGATGGATGAGAGTGTACTCGAGTACACTCTCATCCATCAAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003592.x-2089s1c1
Sequence:CCGGCGTGGTTATATCAGTTGTCTACTCGAGTAGACAACTGATATAACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003592.x-2709s1c1
Sequence:CCGGCCCGCAGCAAATAGTTCATGTCTCGAGACATGAACTATTTGCTGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_003592.2-1195s21c1
Sequence:CCGGGCACACAAGATGAATTAGCAACTCGAGTTGCTAATTCATCTTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318416    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003592.2-2709s21c1
Sequence:CCGGCCCGCAGCAAATAGTTCATGTCTCGAGACATGAACTATTTGCTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_003592.2-2089s21c1
Sequence:CCGGCGTGGTTATATCAGTTGTCTACTCGAGTAGACAACTGATATAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003592.2-1806s21c1
Sequence:CCGGGCCAGCATGATCTCCAAGTTACTCGAGTAACTTGGAGATCATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003592
VALIDATED
CUL1 MISSION shRNA Lentiviral Transduction Particles
cullin 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003592.x-1195s1c1
Sequence:CCGGGCACACAAGATGAATTAGCAACTCGAGTTGCTAATTCATCTTGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003592.x-1806s1c1
Sequence:CCGGGCCAGCATGATCTCCAAGTTACTCGAGTAACTTGGAGATCATGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003592.x-675s1c1
Sequence:CCGGGATTTGATGGATGAGAGTGTACTCGAGTACACTCTCATCCATCAAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003592.x-2089s1c1
Sequence:CCGGCGTGGTTATATCAGTTGTCTACTCGAGTAGACAACTGATATAACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003592.x-2709s1c1
Sequence:CCGGCCCGCAGCAAATAGTTCATGTCTCGAGACATGAACTATTTGCTGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_003592.2-1195s21c1
Sequence:CCGGGCACACAAGATGAATTAGCAACTCGAGTTGCTAATTCATCTTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318416    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003592.2-2709s21c1
Sequence:CCGGCCCGCAGCAAATAGTTCATGTCTCGAGACATGAACTATTTGCTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_003592.2-2089s21c1
Sequence:CCGGCGTGGTTATATCAGTTGTCTACTCGAGTAGACAACTGATATAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003592.2-1806s21c1
Sequence:CCGGGCCAGCATGATCTCCAAGTTACTCGAGTAACTTGGAGATCATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012042
VALIDATED
CUL1 MISSION shRNA Bacterial Glycerol Stock
cullin 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012042.3-2919s1c1
Sequence:CCGGCCGCACTTAAATCAATACATTCTCGAGAATGTATTGATTTAAGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012042.3-1280s1c1
Sequence:CCGGGCCGCATGTATAATCTTGTATCTCGAGATACAAGATTATACATGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012042.3-2576s1c1
Sequence:CCGGGCATTGATATTCTCATCGAAACTCGAGTTTCGATGAGAATATCAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012042.3-2288s1c1
Sequence:CCGGCCAATGTTGATGAGGTGGAATCTCGAGATTCCACCTCATCAACATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012042.3-575s1c1
Sequence:CCGGGCTTGGAGTTATACAAGCGATCTCGAGATCGCTTGTATAACTCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012042.3-1280s21c1
Sequence:CCGGGCCGCATGTATAATCTTGTATCTCGAGATACAAGATTATACATGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012042.3-2288s21c1
Sequence:CCGGCCAATGTTGATGAGGTGGAATCTCGAGATTCCACCTCATCAACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012042.3-2576s21c1
Sequence:CCGGGCATTGATATTCTCATCGAAACTCGAGTTTCGATGAGAATATCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012042.3-2919s21c1
Sequence:CCGGCCGCACTTAAATCAATACATTCTCGAGAATGTATTGATTTAAGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012042
VALIDATED
CUL1 MISSION shRNA shRNA Plasmid DNA
cullin 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012042.3-2919s1c1
Sequence:CCGGCCGCACTTAAATCAATACATTCTCGAGAATGTATTGATTTAAGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012042.3-1280s1c1
Sequence:CCGGGCCGCATGTATAATCTTGTATCTCGAGATACAAGATTATACATGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012042.3-2576s1c1
Sequence:CCGGGCATTGATATTCTCATCGAAACTCGAGTTTCGATGAGAATATCAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012042.3-2288s1c1
Sequence:CCGGCCAATGTTGATGAGGTGGAATCTCGAGATTCCACCTCATCAACATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012042.3-575s1c1
Sequence:CCGGGCTTGGAGTTATACAAGCGATCTCGAGATCGCTTGTATAACTCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012042.3-1280s21c1
Sequence:CCGGGCCGCATGTATAATCTTGTATCTCGAGATACAAGATTATACATGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012042.3-2288s21c1
Sequence:CCGGCCAATGTTGATGAGGTGGAATCTCGAGATTCCACCTCATCAACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012042.3-2576s21c1
Sequence:CCGGGCATTGATATTCTCATCGAAACTCGAGTTTCGATGAGAATATCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012042.3-2919s21c1
Sequence:CCGGCCGCACTTAAATCAATACATTCTCGAGAATGTATTGATTTAAGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012042
VALIDATED
CUL1 MISSION shRNA Lentiviral Transduction Particles
cullin 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012042.3-2919s1c1
Sequence:CCGGCCGCACTTAAATCAATACATTCTCGAGAATGTATTGATTTAAGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012042.3-1280s1c1
Sequence:CCGGGCCGCATGTATAATCTTGTATCTCGAGATACAAGATTATACATGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012042.3-2576s1c1
Sequence:CCGGGCATTGATATTCTCATCGAAACTCGAGTTTCGATGAGAATATCAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012042.3-2288s1c1
Sequence:CCGGCCAATGTTGATGAGGTGGAATCTCGAGATTCCACCTCATCAACATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012042.3-575s1c1
Sequence:CCGGGCTTGGAGTTATACAAGCGATCTCGAGATCGCTTGTATAACTCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012042.3-1280s21c1
Sequence:CCGGGCCGCATGTATAATCTTGTATCTCGAGATACAAGATTATACATGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012042.3-2288s21c1
Sequence:CCGGCCAATGTTGATGAGGTGGAATCTCGAGATTCCACCTCATCAACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012042.3-2576s21c1
Sequence:CCGGGCATTGATATTCTCATCGAAACTCGAGTTTCGATGAGAATATCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012042.3-2919s21c1
Sequence:CCGGCCGCACTTAAATCAATACATTCTCGAGAATGTATTGATTTAAGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks