EMAIL THIS PAGE TO A FRIEND
107 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029402 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029402 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029402 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003591 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003591 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003591 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003591 Rosetta Predictions human pricing
NM_001108417 Rosetta Predictions rat pricing
NM_029402 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003591 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093148 predicted 1558
2 SASI_Hs01_00093149 predicted 2094
3 SASI_Hs01_00093150 predicted 1308
4 SASI_Hs01_00093151 predicted 2360
5 SASI_Hs01_00093152 predicted 2217
6 SASI_Hs01_00093153 predicted 2245
7 SASI_Hs02_00335919 predicted 1620
8 SASI_Hs02_00335920 predicted 526
9 SASI_Hs01_00093154 predicted 1347
10 SASI_Hs01_00093155 predicted 645
11 SASI_Hs01_00093156 predicted 697
12 SASI_Hs01_00093157 predicted 416
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108417 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238449 predicted 2240
2 SASI_Rn02_00238450 predicted 354
3 SASI_Rn02_00238451 predicted 1639
4 SASI_Rn02_00238452 predicted 251
5 SASI_Rn02_00238453 predicted 2263
6 SASI_Rn02_00238454 predicted 259
7 SASI_Rn02_00238455 predicted 1970
8 SASI_Rn02_00238456 predicted 1072
9 SASI_Rn02_00238457 predicted 846
10 SASI_Rn02_00238458 predicted 2187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029402 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335297 predicted 2298
2 SASI_Mm01_00163295 predicted 1904
3 SASI_Mm02_00335298 predicted 1186
4 SASI_Mm01_00163297 predicted 2302
5 SASI_Mm01_00163298 predicted 251
6 SASI_Mm01_00163299 predicted 351
7 SASI_Mm01_00163300 predicted 1203
8 SASI_Mm02_00335299 predicted 304
9 SASI_Mm01_00163301 predicted 2329
10 SASI_Mm02_00335300 predicted 2197
11 SASI_Mm01_00163296 predicted 848
12 SASI_Mm01_00163302 predicted 1490
13 SASI_Mm01_00163303 predicted 524
14 SASI_Mm01_00163304 predicted 977
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029402
VALIDATED
CUL2 MISSION shRNA Bacterial Glycerol Stock
cullin 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029402.3-556s21c1
Sequence:CCGGGCTGATATACAGTATGGCTATCTCGAGATAGCCATACTGTATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029402.3-487s21c1
Sequence:CCGGGCCGACTATATGGACTGCTTACTCGAGTAAGCAGTCCATATAGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029402.3-957s21c1
Sequence:CCGGGCATCCAAGTTCATATACTAACTCGAGTTAGTATATGAACTTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029402.3-1644s21c1
Sequence:CCGGCGCTGATTTGAACAATAAGTTCTCGAGAACTTATTGTTCAAATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029402.1-457s1c1
Sequence:CCGGGCCGACTATATGGACTGCTTACTCGAGTAAGCAGTCCATATAGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029402.1-1614s1c1
Sequence:CCGGCGCTGATTTGAACAATAAGTTCTCGAGAACTTATTGTTCAAATCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029402.1-526s1c1
Sequence:CCGGGCTGATATACAGTATGGCTATCTCGAGATAGCCATACTGTATATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029402.1-3004s1c1
Sequence:CCGGCGGAATACTATGCAGTGACTTCTCGAGAAGTCACTGCATAGTATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029402.1-927s1c1
Sequence:CCGGGCATCCAAGTTCATATACTAACTCGAGTTAGTATATGAACTTGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029402
VALIDATED
CUL2 MISSION shRNA shRNA Plasmid DNA
cullin 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029402.3-556s21c1
Sequence:CCGGGCTGATATACAGTATGGCTATCTCGAGATAGCCATACTGTATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029402.3-487s21c1
Sequence:CCGGGCCGACTATATGGACTGCTTACTCGAGTAAGCAGTCCATATAGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029402.3-957s21c1
Sequence:CCGGGCATCCAAGTTCATATACTAACTCGAGTTAGTATATGAACTTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029402.3-1644s21c1
Sequence:CCGGCGCTGATTTGAACAATAAGTTCTCGAGAACTTATTGTTCAAATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029402.1-457s1c1
Sequence:CCGGGCCGACTATATGGACTGCTTACTCGAGTAAGCAGTCCATATAGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029402.1-1614s1c1
Sequence:CCGGCGCTGATTTGAACAATAAGTTCTCGAGAACTTATTGTTCAAATCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029402.1-526s1c1
Sequence:CCGGGCTGATATACAGTATGGCTATCTCGAGATAGCCATACTGTATATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029402.1-3004s1c1
Sequence:CCGGCGGAATACTATGCAGTGACTTCTCGAGAAGTCACTGCATAGTATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029402.1-927s1c1
Sequence:CCGGGCATCCAAGTTCATATACTAACTCGAGTTAGTATATGAACTTGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029402
VALIDATED
CUL2 MISSION shRNA Lentiviral Transduction Particles
cullin 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029402.3-556s21c1
Sequence:CCGGGCTGATATACAGTATGGCTATCTCGAGATAGCCATACTGTATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029402.3-487s21c1
Sequence:CCGGGCCGACTATATGGACTGCTTACTCGAGTAAGCAGTCCATATAGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029402.3-957s21c1
Sequence:CCGGGCATCCAAGTTCATATACTAACTCGAGTTAGTATATGAACTTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029402.3-1644s21c1
Sequence:CCGGCGCTGATTTGAACAATAAGTTCTCGAGAACTTATTGTTCAAATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029402.1-457s1c1
Sequence:CCGGGCCGACTATATGGACTGCTTACTCGAGTAAGCAGTCCATATAGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029402.1-1614s1c1
Sequence:CCGGCGCTGATTTGAACAATAAGTTCTCGAGAACTTATTGTTCAAATCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029402.1-526s1c1
Sequence:CCGGGCTGATATACAGTATGGCTATCTCGAGATAGCCATACTGTATATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029402.1-3004s1c1
Sequence:CCGGCGGAATACTATGCAGTGACTTCTCGAGAAGTCACTGCATAGTATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029402.1-927s1c1
Sequence:CCGGGCATCCAAGTTCATATACTAACTCGAGTTAGTATATGAACTTGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003591
VALIDATED
CUL2 MISSION shRNA Bacterial Glycerol Stock
cullin 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003591.2-365s21c1
Sequence:CCGGCCCTTGGAGAAAGACTTTATACTCGAGTATAAAGTCTTTCTCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003591.2-2302s21c1
Sequence:CCGGGCCCTTATTCAAGAGGTGATTCTCGAGAATCACCTCTTGAATAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003591.2-1622s21c1
Sequence:CCGGGCAAGCTACATCGGATGTATACTCGAGTATACATCCGATGTAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003591.2-2734s21c1
Sequence:CCGGCGTTTGCAGTTGATGTGTCTTCTCGAGAAGACACATCAACTGCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006522    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003591.2-2734s1c1
Sequence:CCGGCGTTTGCAGTTGATGTGTCTTCTCGAGAAGACACATCAACTGCAAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003591.2-2302s1c1
Sequence:CCGGGCCCTTATTCAAGAGGTGATTCTCGAGAATCACCTCTTGAATAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003591.2-1622s1c1
Sequence:CCGGGCAAGCTACATCGGATGTATACTCGAGTATACATCCGATGTAGCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003591.2-365s1c1
Sequence:CCGGCCCTTGGAGAAAGACTTTATACTCGAGTATAAAGTCTTTCTCCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003591.2-502s1c1
Sequence:CCGGGCAGACTATATGGACTGCTTACTCGAGTAAGCAGTCCATATAGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003591
VALIDATED
CUL2 MISSION shRNA shRNA Plasmid DNA
cullin 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003591.2-365s21c1
Sequence:CCGGCCCTTGGAGAAAGACTTTATACTCGAGTATAAAGTCTTTCTCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003591.2-2302s21c1
Sequence:CCGGGCCCTTATTCAAGAGGTGATTCTCGAGAATCACCTCTTGAATAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003591.2-1622s21c1
Sequence:CCGGGCAAGCTACATCGGATGTATACTCGAGTATACATCCGATGTAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003591.2-2734s21c1
Sequence:CCGGCGTTTGCAGTTGATGTGTCTTCTCGAGAAGACACATCAACTGCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006522    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003591.2-2734s1c1
Sequence:CCGGCGTTTGCAGTTGATGTGTCTTCTCGAGAAGACACATCAACTGCAAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003591.2-2302s1c1
Sequence:CCGGGCCCTTATTCAAGAGGTGATTCTCGAGAATCACCTCTTGAATAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003591.2-1622s1c1
Sequence:CCGGGCAAGCTACATCGGATGTATACTCGAGTATACATCCGATGTAGCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003591.2-365s1c1
Sequence:CCGGCCCTTGGAGAAAGACTTTATACTCGAGTATAAAGTCTTTCTCCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003591.2-502s1c1
Sequence:CCGGGCAGACTATATGGACTGCTTACTCGAGTAAGCAGTCCATATAGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003591
VALIDATED
CUL2 MISSION shRNA Lentiviral Transduction Particles
cullin 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003591.2-365s21c1
Sequence:CCGGCCCTTGGAGAAAGACTTTATACTCGAGTATAAAGTCTTTCTCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003591.2-2302s21c1
Sequence:CCGGGCCCTTATTCAAGAGGTGATTCTCGAGAATCACCTCTTGAATAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003591.2-1622s21c1
Sequence:CCGGGCAAGCTACATCGGATGTATACTCGAGTATACATCCGATGTAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003591.2-2734s21c1
Sequence:CCGGCGTTTGCAGTTGATGTGTCTTCTCGAGAAGACACATCAACTGCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006522    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003591.2-2734s1c1
Sequence:CCGGCGTTTGCAGTTGATGTGTCTTCTCGAGAAGACACATCAACTGCAAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003591.2-2302s1c1
Sequence:CCGGGCCCTTATTCAAGAGGTGATTCTCGAGAATCACCTCTTGAATAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003591.2-1622s1c1
Sequence:CCGGGCAAGCTACATCGGATGTATACTCGAGTATACATCCGATGTAGCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003591.2-365s1c1
Sequence:CCGGCCCTTGGAGAAAGACTTTATACTCGAGTATAAAGTCTTTCTCCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003591.2-502s1c1
Sequence:CCGGGCAGACTATATGGACTGCTTACTCGAGTAAGCAGTCCATATAGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks