EMAIL THIS PAGE TO A FRIEND

CUL3

cullin 3

183 Gene Product Result for
Synonyms: CUL-3 PHA2E
Gene ID:
Human(8452) Summary: This gene encodes a member of the cullin protein family. The encoded protein plays a critical role in the polyubiquitination and subsequent degradation of specific protein substrates as the core component and scaffold protein of an E3 ubiquitin ligase complex. Complexes including the encoded protein may also play a role in late endosome maturation. Mutations in this gene are a cause of type 2E pseudohypoaldosteronism. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
Mouse(26554) cullin 3
Rat(301555) cullin 3
sheep(101122669) cullin 3
chicken(424804) cullin 3
dog(477392) cullin 3
cow(534325) cullin 3
Horse(100061420) cullin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016716 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016716 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016716 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003590 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003590 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003590 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003590 Rosetta Predictions human pricing
NM_001106923 Rosetta Predictions rat pricing
NM_016716 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003590 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102205 predicted 1325
2 SASI_Hs01_00102207 predicted 521
3 SASI_Hs02_00335916 predicted 1350
4 SASI_Hs01_00102209 predicted 843
5 SASI_Hs01_00102210 predicted 1766
6 SASI_Hs02_00335917 predicted 1385
7 SASI_Hs01_00102211 predicted 1766
8 SASI_Hs01_00102213 predicted 1226
9 SASI_Hs01_00102214 predicted 1156
10 SASI_Hs02_00335918 predicted 829
11 SASI_Hs01_00102206 predicted 2585
12 SASI_Hs01_00102208 predicted 2641
13 SASI_Hs01_00102212 predicted 2514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106923 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223736 predicted 1249
2 SASI_Rn02_00223737 predicted 1350
3 SASI_Rn02_00223738 predicted 353
4 SASI_Rn02_00223739 predicted 1386
5 SASI_Rn02_00223740 predicted 2135
6 SASI_Rn02_00223741 predicted 2184
7 SASI_Rn02_00223742 predicted 384
8 SASI_Rn02_00223743 predicted 2036
9 SASI_Rn02_00223744 predicted 283
10 SASI_Rn02_00223745 predicted 1320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016716 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323408 predicted 577
2 SASI_Mm01_00106986 predicted 818
3 SASI_Mm01_00106988 predicted 461
4 SASI_Mm01_00106989 predicted 1057
5 SASI_Mm01_00106990 predicted 1561
6 SASI_Mm01_00106991 predicted 2319
7 SASI_Mm01_00106992 predicted 2365
8 SASI_Mm01_00106993 predicted 566
9 SASI_Mm01_00106994 predicted 336
10 SASI_Mm01_00106995 predicted 1503
11 SASI_Mm01_00106987 predicted 1554
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016716
VALIDATED
CUL3 MISSION shRNA Bacterial Glycerol Stock
cullin 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016716.2-2561s1c1
Sequence:CCGGCGTGTTATAGACCACTCAGATCTCGAGATCTGAGTGGTCTATAACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016716.2-1170s1c1
Sequence:CCGGCCAGGGCTTATTGGATCTAAACTCGAGTTTAGATCCAATAAGCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016716.2-586s1c1
Sequence:CCGGCGAGATCAAGTTGTACGGTATCTCGAGATACCGTACAACTTGATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016716.2-1209s1c1
Sequence:CCGGCCTCCAAGAATCCTTCAATAACTCGAGTTATTGAAGGATTCTTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016716.2-2268s1c1
Sequence:CCGGGCGAATAATGAAGTCTAGGAACTCGAGTTCCTAGACTTCATTATTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016716.4-2075s21c1
Sequence:GTACCGGGATAGAAAGTGGCCACATATTCTCGAGAATATGTGGCCACTTTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016716.4-468s21c1
Sequence:CCGGGTGATGATTAGAGACATATTACTCGAGTAATATGTCTCTAATCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016716.4-384s21c1
Sequence:CCGGGTGCGAGAAGATGTACTAAATCTCGAGATTTAGTACATCTTCTCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016716.4-2524s21c1
Sequence:CCGGTAAATTGCAGTACGTGTTATACTCGAGTATAACACGTACTGCAATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016716.4-2231s21c1
Sequence:CCGGAGCTGCTATAGTGCGAATAATCTCGAGATTATTCGCACTATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016716
VALIDATED
CUL3 MISSION shRNA shRNA Plasmid DNA
cullin 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016716.2-2561s1c1
Sequence:CCGGCGTGTTATAGACCACTCAGATCTCGAGATCTGAGTGGTCTATAACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016716.2-1170s1c1
Sequence:CCGGCCAGGGCTTATTGGATCTAAACTCGAGTTTAGATCCAATAAGCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016716.2-586s1c1
Sequence:CCGGCGAGATCAAGTTGTACGGTATCTCGAGATACCGTACAACTTGATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016716.2-1209s1c1
Sequence:CCGGCCTCCAAGAATCCTTCAATAACTCGAGTTATTGAAGGATTCTTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016716.2-2268s1c1
Sequence:CCGGGCGAATAATGAAGTCTAGGAACTCGAGTTCCTAGACTTCATTATTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016716.4-2075s21c1
Sequence:GTACCGGGATAGAAAGTGGCCACATATTCTCGAGAATATGTGGCCACTTTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016716.4-468s21c1
Sequence:CCGGGTGATGATTAGAGACATATTACTCGAGTAATATGTCTCTAATCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016716.4-384s21c1
Sequence:CCGGGTGCGAGAAGATGTACTAAATCTCGAGATTTAGTACATCTTCTCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016716.4-2524s21c1
Sequence:CCGGTAAATTGCAGTACGTGTTATACTCGAGTATAACACGTACTGCAATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016716.4-2231s21c1
Sequence:CCGGAGCTGCTATAGTGCGAATAATCTCGAGATTATTCGCACTATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016716
VALIDATED
CUL3 MISSION shRNA Lentiviral Transduction Particles
cullin 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016716.2-2561s1c1
Sequence:CCGGCGTGTTATAGACCACTCAGATCTCGAGATCTGAGTGGTCTATAACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016716.2-1170s1c1
Sequence:CCGGCCAGGGCTTATTGGATCTAAACTCGAGTTTAGATCCAATAAGCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016716.2-586s1c1
Sequence:CCGGCGAGATCAAGTTGTACGGTATCTCGAGATACCGTACAACTTGATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016716.2-1209s1c1
Sequence:CCGGCCTCCAAGAATCCTTCAATAACTCGAGTTATTGAAGGATTCTTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016716.2-2268s1c1
Sequence:CCGGGCGAATAATGAAGTCTAGGAACTCGAGTTCCTAGACTTCATTATTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016716.4-2075s21c1
Sequence:GTACCGGGATAGAAAGTGGCCACATATTCTCGAGAATATGTGGCCACTTTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016716.4-468s21c1
Sequence:CCGGGTGATGATTAGAGACATATTACTCGAGTAATATGTCTCTAATCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016716.4-384s21c1
Sequence:CCGGGTGCGAGAAGATGTACTAAATCTCGAGATTTAGTACATCTTCTCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016716.4-2524s21c1
Sequence:CCGGTAAATTGCAGTACGTGTTATACTCGAGTATAACACGTACTGCAATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016716.4-2231s21c1
Sequence:CCGGAGCTGCTATAGTGCGAATAATCTCGAGATTATTCGCACTATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003590
VALIDATED
CUL3 MISSION shRNA Bacterial Glycerol Stock
cullin 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003590.1-3260s1c1
Sequence:CCGGCCCTGTTGTAATTTGAGATTTCTCGAGAAATCTCAAATTACAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003590.1-1234s1c1
Sequence:CCGGCGTGTGCCAAATGGTTTGAAACTCGAGTTTCAAACCATTTGGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003590.1-2445s1c1
Sequence:CCGGGCGGATAATGAAATCTAGAAACTCGAGTTTCTAGATTTCATTATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003590.1-457s1c1
Sequence:CCGGCGTAAGAATAACAGTGGTCTTCTCGAGAAGACCACTGTTATTCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003590.1-2263s1c1
Sequence:CCGGCCCAAATCAAAGGAAATAGAACTCGAGTTCTATTTCCTTTGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003590.3-1402s21c1
Sequence:CCGGGACTATATCCAGGGCTTATTGCTCGAGCAATAAGCCCTGGATATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003590.3-915s21c1
Sequence:CCGGCGTAGACAGAGGCGCAATAAGCTCGAGCTTATTGCGCCTCTGTCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_003590.3-1297s21c1
Sequence:CCGGCGTGTGCCAAATGGTTTGAAACTCGAGTTTCAAACCATTTGGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003590.3-649s21c1
Sequence:CCGGGTGCGAGAAGATGTACTAAATCTCGAGATTTAGTACATCTTCTCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_003590.3-2870s21c1
Sequence:CCGGTTCAGGCTTTACAACGTTTATCTCGAGATAAACGTTGTAAAGCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003590
VALIDATED
CUL3 MISSION shRNA shRNA Plasmid DNA
cullin 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003590.1-3260s1c1
Sequence:CCGGCCCTGTTGTAATTTGAGATTTCTCGAGAAATCTCAAATTACAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003590.1-1234s1c1
Sequence:CCGGCGTGTGCCAAATGGTTTGAAACTCGAGTTTCAAACCATTTGGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003590.1-2445s1c1
Sequence:CCGGGCGGATAATGAAATCTAGAAACTCGAGTTTCTAGATTTCATTATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003590.1-457s1c1
Sequence:CCGGCGTAAGAATAACAGTGGTCTTCTCGAGAAGACCACTGTTATTCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003590.1-2263s1c1
Sequence:CCGGCCCAAATCAAAGGAAATAGAACTCGAGTTCTATTTCCTTTGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003590.3-1402s21c1
Sequence:CCGGGACTATATCCAGGGCTTATTGCTCGAGCAATAAGCCCTGGATATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003590.3-915s21c1
Sequence:CCGGCGTAGACAGAGGCGCAATAAGCTCGAGCTTATTGCGCCTCTGTCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_003590.3-1297s21c1
Sequence:CCGGCGTGTGCCAAATGGTTTGAAACTCGAGTTTCAAACCATTTGGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003590.3-649s21c1
Sequence:CCGGGTGCGAGAAGATGTACTAAATCTCGAGATTTAGTACATCTTCTCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_003590.3-2870s21c1
Sequence:CCGGTTCAGGCTTTACAACGTTTATCTCGAGATAAACGTTGTAAAGCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003590
VALIDATED
CUL3 MISSION shRNA Lentiviral Transduction Particles
cullin 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003590.1-3260s1c1
Sequence:CCGGCCCTGTTGTAATTTGAGATTTCTCGAGAAATCTCAAATTACAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003590.1-1234s1c1
Sequence:CCGGCGTGTGCCAAATGGTTTGAAACTCGAGTTTCAAACCATTTGGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003590.1-2445s1c1
Sequence:CCGGGCGGATAATGAAATCTAGAAACTCGAGTTTCTAGATTTCATTATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003590.1-457s1c1
Sequence:CCGGCGTAAGAATAACAGTGGTCTTCTCGAGAAGACCACTGTTATTCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003590.1-2263s1c1
Sequence:CCGGCCCAAATCAAAGGAAATAGAACTCGAGTTCTATTTCCTTTGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003590.3-1402s21c1
Sequence:CCGGGACTATATCCAGGGCTTATTGCTCGAGCAATAAGCCCTGGATATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003590.3-915s21c1
Sequence:CCGGCGTAGACAGAGGCGCAATAAGCTCGAGCTTATTGCGCCTCTGTCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_003590.3-1297s21c1
Sequence:CCGGCGTGTGCCAAATGGTTTGAAACTCGAGTTTCAAACCATTTGGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003590.3-649s21c1
Sequence:CCGGGTGCGAGAAGATGTACTAAATCTCGAGATTTAGTACATCTTCTCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_003590.3-2870s21c1
Sequence:CCGGTTCAGGCTTTACAACGTTTATCTCGAGATAAACGTTGTAAAGCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks