EMAIL THIS PAGE TO A FRIEND

CUL4A

cullin 4A

149 Gene Product Result for
Gene ID:
Human(8451) Summary: CUL4A is the ubiquitin ligase component of a multimeric complex involved in the degradation of DNA damage-response proteins (Liu et al., 2009 [PubMed 19481525]
Mouse(99375) cullin 4A
Rat(361181) cullin 4A
Zebrafish(394002) cullin 4A
dog(607683) cullin 4A
Horse(100033930) cullin 4A
cow(617935) cullin 4A
chicken(418744) cullin 4A
sheep(101119145) cullin 4A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146207 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146207 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146207 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003589 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003589 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003589 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008895 Rosetta Predictions human pricing
NM_003589 Rosetta Predictions human pricing
NM_001127301 Rosetta Predictions rat pricing
NM_146207 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008895 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146692 predicted 1906
2 SASI_Hs01_00146693 predicted 1567
3 SASI_Hs01_00146694 predicted 932
4 SASI_Hs01_00146695 predicted 2189
5 SASI_Hs01_00146696 predicted 515
6 SASI_Hs01_00146698 predicted 1593
7 SASI_Hs01_00146699 predicted 1325
8 SASI_Hs01_00146700 predicted 1253
9 SASI_Hs02_00305589 predicted 1605
10 SASI_Hs02_00305590 predicted 2213
11 SASI_Hs01_00146697 predicted 1515
12 SASI_Hs01_00146701 predicted 1347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003589 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146882 predicted 1850
2 SASI_Hs01_00146883 predicted 1499
3 SASI_Hs01_00146884 predicted 873
4 SASI_Hs01_00146885 predicted 2123
5 SASI_Hs01_00146886 predicted 459
6 SASI_Hs01_00146888 predicted 1529
7 SASI_Hs01_00146889 predicted 1263
8 SASI_Hs01_00146890 predicted 1193
9 SASI_Hs02_00335914 predicted 1550
10 SASI_Hs02_00335915 predicted 2152
11 SASI_Hs01_00146887 predicted 1454
12 SASI_Hs01_00146891 predicted 1284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127301 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253573 predicted 445
2 SASI_Rn02_00253574 predicted 1184
3 SASI_Rn02_00253575 predicted 281
4 SASI_Rn02_00253576 predicted 698
5 SASI_Rn02_00253577 predicted 2194
6 SASI_Rn02_00253578 predicted 1743
7 SASI_Rn02_00253579 predicted 1043
8 SASI_Rn02_00253580 predicted 1515
9 SASI_Rn02_00253581 predicted 880
10 SASI_Rn02_00253582 predicted 833
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146207 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065901 predicted 858
2 SASI_Mm02_00341906 predicted 465
3 SASI_Mm01_00065902 predicted 502
4 SASI_Mm01_00065903 predicted 909
5 SASI_Mm02_00341907 predicted 2273
6 SASI_Mm02_00341908 predicted 1981
7 SASI_Mm02_00341909 predicted 1532
8 SASI_Mm01_00065906 predicted 1935
9 SASI_Mm01_00065908 predicted 2261
10 SASI_Mm01_00065909 predicted 1060
11 SASI_Mm01_00065904 predicted 1783
12 SASI_Mm01_00065905 predicted 786
13 SASI_Mm01_00065907 predicted 591
14 SASI_Mm01_00065910 predicted 677
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146207
VALIDATED
CUL4A MISSION shRNA Bacterial Glycerol Stock
cullin 4A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146207.2-2102s21c1
Sequence:CCGGCCAGGATAGACAGTACCAGATCTCGAGATCTGGTACTGTCTATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146207.2-674s21c1
Sequence:CCGGGCTTCGGAGTTTGCTAAGCATCTCGAGATGCTTAGCAAACTCCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146207.2-2274s21c1
Sequence:CCGGCGAGACAAAGACAGTCCAAATCTCGAGATTTGGACTGTCTTTGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146207.2-707s21c1
Sequence:CCGGCCAGGTGTACAAAGACTCATTCTCGAGAATGAGTCTTTGTACACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146207.1-3051s1c1
Sequence:CCGGCCCTGGCACTATATGGAGTTTCTCGAGAAACTCCATATAGTGCCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146207.1-2252s1c1
Sequence:CCGGCGAGACAAAGACAGTCCAAATCTCGAGATTTGGACTGTCTTTGTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146207.1-2080s1c1
Sequence:CCGGCCAGGATAGACAGTACCAGATCTCGAGATCTGGTACTGTCTATCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146207.1-685s1c1
Sequence:CCGGCCAGGTGTACAAAGACTCATTCTCGAGAATGAGTCTTTGTACACCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146207.1-652s1c1
Sequence:CCGGGCTTCGGAGTTTGCTAAGCATCTCGAGATGCTTAGCAAACTCCGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146207
VALIDATED
CUL4A MISSION shRNA shRNA Plasmid DNA
cullin 4A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146207.2-2102s21c1
Sequence:CCGGCCAGGATAGACAGTACCAGATCTCGAGATCTGGTACTGTCTATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146207.2-674s21c1
Sequence:CCGGGCTTCGGAGTTTGCTAAGCATCTCGAGATGCTTAGCAAACTCCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146207.2-2274s21c1
Sequence:CCGGCGAGACAAAGACAGTCCAAATCTCGAGATTTGGACTGTCTTTGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146207.2-707s21c1
Sequence:CCGGCCAGGTGTACAAAGACTCATTCTCGAGAATGAGTCTTTGTACACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146207.1-3051s1c1
Sequence:CCGGCCCTGGCACTATATGGAGTTTCTCGAGAAACTCCATATAGTGCCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146207.1-2252s1c1
Sequence:CCGGCGAGACAAAGACAGTCCAAATCTCGAGATTTGGACTGTCTTTGTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146207.1-2080s1c1
Sequence:CCGGCCAGGATAGACAGTACCAGATCTCGAGATCTGGTACTGTCTATCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146207.1-685s1c1
Sequence:CCGGCCAGGTGTACAAAGACTCATTCTCGAGAATGAGTCTTTGTACACCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146207.1-652s1c1
Sequence:CCGGGCTTCGGAGTTTGCTAAGCATCTCGAGATGCTTAGCAAACTCCGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146207
VALIDATED
CUL4A MISSION shRNA Lentiviral Transduction Particles
cullin 4A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146207.2-2102s21c1
Sequence:CCGGCCAGGATAGACAGTACCAGATCTCGAGATCTGGTACTGTCTATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146207.2-674s21c1
Sequence:CCGGGCTTCGGAGTTTGCTAAGCATCTCGAGATGCTTAGCAAACTCCGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146207.2-2274s21c1
Sequence:CCGGCGAGACAAAGACAGTCCAAATCTCGAGATTTGGACTGTCTTTGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146207.2-707s21c1
Sequence:CCGGCCAGGTGTACAAAGACTCATTCTCGAGAATGAGTCTTTGTACACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146207.1-3051s1c1
Sequence:CCGGCCCTGGCACTATATGGAGTTTCTCGAGAAACTCCATATAGTGCCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146207.1-2252s1c1
Sequence:CCGGCGAGACAAAGACAGTCCAAATCTCGAGATTTGGACTGTCTTTGTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146207.1-2080s1c1
Sequence:CCGGCCAGGATAGACAGTACCAGATCTCGAGATCTGGTACTGTCTATCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146207.1-685s1c1
Sequence:CCGGCCAGGTGTACAAAGACTCATTCTCGAGAATGAGTCTTTGTACACCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146207.1-652s1c1
Sequence:CCGGGCTTCGGAGTTTGCTAAGCATCTCGAGATGCTTAGCAAACTCCGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003589
VALIDATED
CUL4A MISSION shRNA Bacterial Glycerol Stock
cullin 4A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000320898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003589.2-2489s21c1
Sequence:CCGGGGACAAGAAGATGTTACTAAACTCGAGTTTAGTAACATCTTCTTGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003589.2-1165s21c1
Sequence:CCGGGCAGAACTGATCGCAAAGCATCTCGAGATGCTTTGCGATCAGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003589.2-815s21c1
Sequence:CCGGGTGTGGAGAAACAGCTATTAGCTCGAGCTAATAGCTGTTTCTCCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003589.2-2164s21c1
Sequence:CCGGCTGATAGACAGAGACTATATGCTCGAGCATATAGTCTCTGTCTATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_003589.2-477s21c1
Sequence:CCGGACTGTTTAGAACCCATATTATCTCGAGATAATATGGGTTCTAAACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003589.1-600s1c1
Sequence:CCGGGCCAAAGGTTAATGCAGGAAACTCGAGTTTCCTGCATTAACCTTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003589.1-1076s1c1
Sequence:CCGGGCAGAACTGATCGCAAAGCATCTCGAGATGCTTTGCGATCAGTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006527    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003589.1-3467s1c1
Sequence:CCGGCCATGATATGTGGTCTAAGAACTCGAGTTCTTAGACCACATATCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003589.1-532s1c1
Sequence:CCGGGCAGGTGTATAAAGATTCATTCTCGAGAATGAATCTTTATACACCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003589.1-629s1c1
Sequence:CCGGCCAGAATATCTTAACCATGTACTCGAGTACATGGTTAAGATATTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003589
VALIDATED
CUL4A MISSION shRNA shRNA Plasmid DNA
cullin 4A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000320898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003589.2-2489s21c1
Sequence:CCGGGGACAAGAAGATGTTACTAAACTCGAGTTTAGTAACATCTTCTTGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003589.2-1165s21c1
Sequence:CCGGGCAGAACTGATCGCAAAGCATCTCGAGATGCTTTGCGATCAGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003589.2-815s21c1
Sequence:CCGGGTGTGGAGAAACAGCTATTAGCTCGAGCTAATAGCTGTTTCTCCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003589.2-2164s21c1
Sequence:CCGGCTGATAGACAGAGACTATATGCTCGAGCATATAGTCTCTGTCTATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_003589.2-477s21c1
Sequence:CCGGACTGTTTAGAACCCATATTATCTCGAGATAATATGGGTTCTAAACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003589.1-600s1c1
Sequence:CCGGGCCAAAGGTTAATGCAGGAAACTCGAGTTTCCTGCATTAACCTTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003589.1-1076s1c1
Sequence:CCGGGCAGAACTGATCGCAAAGCATCTCGAGATGCTTTGCGATCAGTTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006527    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003589.1-3467s1c1
Sequence:CCGGCCATGATATGTGGTCTAAGAACTCGAGTTCTTAGACCACATATCATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003589.1-532s1c1
Sequence:CCGGGCAGGTGTATAAAGATTCATTCTCGAGAATGAATCTTTATACACCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003589.1-629s1c1
Sequence:CCGGCCAGAATATCTTAACCATGTACTCGAGTACATGGTTAAGATATTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003589
VALIDATED
CUL4A MISSION shRNA Lentiviral Transduction Particles
cullin 4A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000320898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003589.2-2489s21c1
Sequence:CCGGGGACAAGAAGATGTTACTAAACTCGAGTTTAGTAACATCTTCTTGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003589.2-1165s21c1
Sequence:CCGGGCAGAACTGATCGCAAAGCATCTCGAGATGCTTTGCGATCAGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003589.2-815s21c1
Sequence:CCGGGTGTGGAGAAACAGCTATTAGCTCGAGCTAATAGCTGTTTCTCCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003589.2-2164s21c1
Sequence:CCGGCTGATAGACAGAGACTATATGCTCGAGCATATAGTCTCTGTCTATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_003589.2-477s21c1
Sequence:CCGGACTGTTTAGAACCCATATTATCTCGAGATAATATGGGTTCTAAACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003589.1-600s1c1
Sequence:CCGGGCCAAAGGTTAATGCAGGAAACTCGAGTTTCCTGCATTAACCTTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003589.1-1076s1c1
Sequence:CCGGGCAGAACTGATCGCAAAGCATCTCGAGATGCTTTGCGATCAGTTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006527    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003589.1-3467s1c1
Sequence:CCGGCCATGATATGTGGTCTAAGAACTCGAGTTCTTAGACCACATATCATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003589.1-532s1c1
Sequence:CCGGGCAGGTGTATAAAGATTCATTCTCGAGAATGAATCTTTATACACCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003589.1-629s1c1
Sequence:CCGGCCAGAATATCTTAACCATGTACTCGAGTACATGGTTAAGATATTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)