EMAIL THIS PAGE TO A FRIEND

CUL4B

cullin 4B

168 Gene Product Result for
Synonyms: MRXHF2 MRXS15 MRXSC SFM2
Gene ID:
Human(8450) Summary: This gene is a member of the cullin family. The encoded protein forms a complex that functions as an E3 ubiquitin ligase and catalyzes the polyubiquitination of specific protein substrates in the cell. The protein interacts with a ring finger protein, and is required for the proteolysis of several regulators of DNA replication including chromatin licensing and DNA replication factor 1 and cyclin E. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(72584) cullin 4B
Rat(302502) cullin 4B
Zebrafish(560313) cullin 4B
cow(539668) cullin 4B
Horse(100033938) cullin 4B
chicken(422364) cullin 4B
dog(492102) cullin 4B
sheep(101113913) cullin 4B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003588 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003588 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003588 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028288 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028288 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028288 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079872 Rosetta Predictions human pricing
NM_003588 Rosetta Predictions human pricing
NM_001106951 Rosetta Predictions rat pricing
NM_001110142 Rosetta Predictions mouse pricing
NM_028288 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079872 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314020 predicted 3108
2 SASI_Hs02_00314021 predicted 1098
3 SASI_Hs02_00314022 predicted 3032
4 SASI_Hs02_00314023 predicted 1765
5 SASI_Hs02_00314024 predicted 2862
6 SASI_Hs02_00314025 predicted 3020
7 SASI_Hs02_00314026 predicted 2910
8 SASI_Hs02_00314027 predicted 2469
9 SASI_Hs02_00314028 predicted 1951
10 SASI_Hs02_00314029 predicted 1304
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003588 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335910 predicted 3269
2 SASI_Hs01_00114202 predicted 1260
3 SASI_Hs02_00335911 predicted 3195
4 SASI_Hs01_00114204 predicted 1935
5 SASI_Hs01_00114205 predicted 3027
6 SASI_Hs02_00335912 predicted 3189
7 SASI_Hs02_00335913 predicted 3073
8 SASI_Hs01_00114208 predicted 2628
9 SASI_Hs01_00114209 predicted 2119
10 SASI_Hs01_00114210 predicted 1462
11 SASI_Hs01_00114203 predicted 1741
12 SASI_Hs01_00114206 predicted 2288
13 SASI_Hs01_00114207 predicted 1395
14 SASI_Hs01_00114211 predicted 1825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106951 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224016 predicted 1599
2 SASI_Rn02_00224017 predicted 3081
3 SASI_Rn02_00224018 predicted 1794
4 SASI_Rn02_00224019 predicted 3047
5 SASI_Rn02_00224020 predicted 2958
6 SASI_Rn02_00224021 predicted 1323
7 SASI_Rn02_00224022 predicted 1458
8 SASI_Rn02_00224023 predicted 3004
9 SASI_Rn02_00224024 predicted 860
10 SASI_Rn02_00224025 predicted 2211
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110142 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304706 predicted 2938
2 SASI_Mm02_00304707 predicted 1798
3 SASI_Mm02_00304708 predicted 3059
4 SASI_Mm02_00304709 predicted 879
5 SASI_Mm02_00304710 predicted 2257
6 SASI_Mm02_00304711 predicted 3022
7 SASI_Mm02_00304712 predicted 1725
8 SASI_Mm02_00304713 predicted 1608
9 SASI_Mm02_00304714 predicted 1868
10 SASI_Mm02_00304715 predicted 1469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028288 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124752 predicted 2875
2 SASI_Mm01_00124753 predicted 1745
3 SASI_Mm01_00124754 predicted 2996
4 SASI_Mm01_00124755 predicted 819
5 SASI_Mm01_00124756 predicted 2204
6 SASI_Mm01_00124757 predicted 2967
7 SASI_Mm01_00124758 predicted 1664
8 SASI_Mm01_00124759 predicted 1554
9 SASI_Mm01_00124760 predicted 1808
10 SASI_Mm01_00124761 predicted 1410
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003588
CUL4B MISSION shRNA Bacterial Glycerol Stock
cullin 4B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003588.2-2029s1c1
Sequence:CCGGGCCATGAAAGAAGCATTTGAACTCGAGTTCAAATGCTTCTTTCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003588.2-1765s1c1
Sequence:CCGGGCAATTCTTCAGAAAGGTTTACTCGAGTAAACCTTTCTGAAGAATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003588.2-2602s1c1
Sequence:CCGGGCAGAATTTAAAGAGGGTAAACTCGAGTTTACCCTCTTTAAATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003588.2-1633s1c1
Sequence:CCGGCCTGAATATCTACATCATGTTCTCGAGAACATGATGTAGATATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003588.2-3088s1c1
Sequence:CCGGCGGGACTACATGGAAAGAGATCTCGAGATCTCTTTCCATGTAGTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003588.3-1800s21c1
Sequence:CCGGGCAATTCTTCAGAAAGGTTTACTCGAGTAAACCTTTCTGAAGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003588.3-1668s21c1
Sequence:CCGGCCTGAATATCTACATCATGTTCTCGAGAACATGATGTAGATATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003588.3-2064s21c1
Sequence:CCGGGCCATGAAAGAAGCATTTGAACTCGAGTTCAAATGCTTCTTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003588.3-2637s21c1
Sequence:CCGGGCAGAATTTAAAGAGGGTAAACTCGAGTTTACCCTCTTTAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003588
CUL4B MISSION shRNA shRNA Plasmid DNA
cullin 4B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003588.2-2029s1c1
Sequence:CCGGGCCATGAAAGAAGCATTTGAACTCGAGTTCAAATGCTTCTTTCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003588.2-1765s1c1
Sequence:CCGGGCAATTCTTCAGAAAGGTTTACTCGAGTAAACCTTTCTGAAGAATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003588.2-2602s1c1
Sequence:CCGGGCAGAATTTAAAGAGGGTAAACTCGAGTTTACCCTCTTTAAATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003588.2-1633s1c1
Sequence:CCGGCCTGAATATCTACATCATGTTCTCGAGAACATGATGTAGATATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003588.2-3088s1c1
Sequence:CCGGCGGGACTACATGGAAAGAGATCTCGAGATCTCTTTCCATGTAGTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003588.3-1800s21c1
Sequence:CCGGGCAATTCTTCAGAAAGGTTTACTCGAGTAAACCTTTCTGAAGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003588.3-1668s21c1
Sequence:CCGGCCTGAATATCTACATCATGTTCTCGAGAACATGATGTAGATATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003588.3-2064s21c1
Sequence:CCGGGCCATGAAAGAAGCATTTGAACTCGAGTTCAAATGCTTCTTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003588.3-2637s21c1
Sequence:CCGGGCAGAATTTAAAGAGGGTAAACTCGAGTTTACCCTCTTTAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003588
CUL4B MISSION shRNA Lentiviral Transduction Particles
cullin 4B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003588.2-2029s1c1
Sequence:CCGGGCCATGAAAGAAGCATTTGAACTCGAGTTCAAATGCTTCTTTCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003588.2-1765s1c1
Sequence:CCGGGCAATTCTTCAGAAAGGTTTACTCGAGTAAACCTTTCTGAAGAATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003588.2-2602s1c1
Sequence:CCGGGCAGAATTTAAAGAGGGTAAACTCGAGTTTACCCTCTTTAAATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003588.2-1633s1c1
Sequence:CCGGCCTGAATATCTACATCATGTTCTCGAGAACATGATGTAGATATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003588.2-3088s1c1
Sequence:CCGGCGGGACTACATGGAAAGAGATCTCGAGATCTCTTTCCATGTAGTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003588.3-1800s21c1
Sequence:CCGGGCAATTCTTCAGAAAGGTTTACTCGAGTAAACCTTTCTGAAGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003588.3-1668s21c1
Sequence:CCGGCCTGAATATCTACATCATGTTCTCGAGAACATGATGTAGATATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003588.3-2064s21c1
Sequence:CCGGGCCATGAAAGAAGCATTTGAACTCGAGTTCAAATGCTTCTTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003588.3-2637s21c1
Sequence:CCGGGCAGAATTTAAAGAGGGTAAACTCGAGTTTACCCTCTTTAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028288
VALIDATED
CUL4B MISSION shRNA Bacterial Glycerol Stock
cullin 4B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028288.3-3100s1c1
Sequence:CCGGTGGGAATAGTTGTGTGGACTTCTCGAGAAGTCCACACAACTATTCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028288.3-1366s1c1
Sequence:CCGGGCTGTCTGATTTGCAAATTTACTCGAGTAAATTTGCAAATCAGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028288.3-568s1c1
Sequence:CCGGCCACGTACCTATACAGAAGAACTCGAGTTCTTCTGTATAGGTACGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028288.3-2444s1c1
Sequence:CCGGGCTGAATTTAAAGAGGGCAAACTCGAGTTTGCCCTCTTTAAATTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028288.3-1825s1c1
Sequence:CCGGCCATATAATTGATACCTGCTTCTCGAGAAGCAGGTATCAATTATATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028288.5-567s21c1
Sequence:CCGGCCACGTACCTATACAGAAGAACTCGAGTTCTTCTGTATAGGTACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028288.5-2293s21c1
Sequence:CCGGATGGGTTACTGGCCAACATATCTCGAGATATGTTGGCCAGTAACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028288.5-2796s21c1
Sequence:CCGGTGCTGCGATCGTTCGAATTATCTCGAGATAATTCGAACGATCGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028288.5-1365s21c1
Sequence:CCGGGCTGTCTGATTTGCAAATTTACTCGAGTAAATTTGCAAATCAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028288.5-3300s21c1
Sequence:CCGGGGTGATTCTTATACATCATTACTCGAGTAATGATGTATAAGAATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028288
VALIDATED
CUL4B MISSION shRNA shRNA Plasmid DNA
cullin 4B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028288.3-3100s1c1
Sequence:CCGGTGGGAATAGTTGTGTGGACTTCTCGAGAAGTCCACACAACTATTCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028288.3-1366s1c1
Sequence:CCGGGCTGTCTGATTTGCAAATTTACTCGAGTAAATTTGCAAATCAGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028288.3-568s1c1
Sequence:CCGGCCACGTACCTATACAGAAGAACTCGAGTTCTTCTGTATAGGTACGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028288.3-2444s1c1
Sequence:CCGGGCTGAATTTAAAGAGGGCAAACTCGAGTTTGCCCTCTTTAAATTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028288.3-1825s1c1
Sequence:CCGGCCATATAATTGATACCTGCTTCTCGAGAAGCAGGTATCAATTATATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028288.5-567s21c1
Sequence:CCGGCCACGTACCTATACAGAAGAACTCGAGTTCTTCTGTATAGGTACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028288.5-2293s21c1
Sequence:CCGGATGGGTTACTGGCCAACATATCTCGAGATATGTTGGCCAGTAACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028288.5-2796s21c1
Sequence:CCGGTGCTGCGATCGTTCGAATTATCTCGAGATAATTCGAACGATCGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028288.5-1365s21c1
Sequence:CCGGGCTGTCTGATTTGCAAATTTACTCGAGTAAATTTGCAAATCAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028288.5-3300s21c1
Sequence:CCGGGGTGATTCTTATACATCATTACTCGAGTAATGATGTATAAGAATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028288
VALIDATED
CUL4B MISSION shRNA Lentiviral Transduction Particles
cullin 4B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028288.3-3100s1c1
Sequence:CCGGTGGGAATAGTTGTGTGGACTTCTCGAGAAGTCCACACAACTATTCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028288.3-1366s1c1
Sequence:CCGGGCTGTCTGATTTGCAAATTTACTCGAGTAAATTTGCAAATCAGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028288.3-568s1c1
Sequence:CCGGCCACGTACCTATACAGAAGAACTCGAGTTCTTCTGTATAGGTACGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028288.3-2444s1c1
Sequence:CCGGGCTGAATTTAAAGAGGGCAAACTCGAGTTTGCCCTCTTTAAATTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028288.3-1825s1c1
Sequence:CCGGCCATATAATTGATACCTGCTTCTCGAGAAGCAGGTATCAATTATATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028288.5-567s21c1
Sequence:CCGGCCACGTACCTATACAGAAGAACTCGAGTTCTTCTGTATAGGTACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028288.5-2293s21c1
Sequence:CCGGATGGGTTACTGGCCAACATATCTCGAGATATGTTGGCCAGTAACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028288.5-2796s21c1
Sequence:CCGGTGCTGCGATCGTTCGAATTATCTCGAGATAATTCGAACGATCGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028288.5-1365s21c1
Sequence:CCGGGCTGTCTGATTTGCAAATTTACTCGAGTAAATTTGCAAATCAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028288.5-3300s21c1
Sequence:CCGGGGTGATTCTTATACATCATTACTCGAGTAATGATGTATAAGAATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks