EMAIL THIS PAGE TO A FRIEND

CUL5

cullin 5

262 Gene Product Result for
Synonyms: VACM-1 VACM1
UniProtKB ID: Q93034, A8K960, O14766, Q9BZC6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003478 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003478 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003478 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027807 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027807 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027807 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003478 Rosetta Predictions human pricing
NM_022683 Rosetta Predictions rat pricing
NM_027807 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003478 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112044 predicted 2553
2 SASI_Hs01_00112046 predicted 1563
3 SASI_Hs01_00112047 predicted 2112
4 SASI_Hs02_00335740 predicted 2985
5 SASI_Hs01_00112048 predicted 675
6 SASI_Hs01_00112049 predicted 1581
7 SASI_Hs02_00335741 predicted 1221
8 SASI_Hs01_00112050 predicted 3019
9 SASI_Hs01_00112051 predicted 2122
10 SASI_Hs01_00112052 predicted 992
11 SASI_Hs01_00112045 predicted 868
12 SASI_Hs01_00112053 predicted 1803
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022683 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032985 predicted 690
2 SASI_Rn01_00032986 predicted 1583
3 SASI_Rn01_00032987 predicted 720
4 SASI_Rn01_00032988 predicted 2260
5 SASI_Rn02_00263468 predicted 301
6 SASI_Rn01_00032989 predicted 1089
7 SASI_Rn01_00032990 predicted 343
8 SASI_Rn01_00032992 predicted 1251
9 SASI_Rn01_00032993 predicted 1272
10 SASI_Rn01_00032994 predicted 754
11 SASI_Rn01_00032991 predicted 1380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027807 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160912 predicted 1871
2 SASI_Mm01_00160913 predicted 1856
3 SASI_Mm01_00160915 predicted 1521
4 SASI_Mm01_00160916 predicted 575
5 SASI_Mm01_00160917 predicted 1550
6 SASI_Mm01_00160918 predicted 1433
7 SASI_Mm01_00160919 predicted 475
8 SASI_Mm01_00160920 predicted 428
9 SASI_Mm01_00160921 predicted 1691
10 SASI_Mm02_00332751 predicted 754
11 SASI_Mm01_00160914 predicted 1435
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003478
VALIDATED
CUL5 MISSION shRNA Bacterial Glycerol Stock
cullin 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003478.3-2147s21c1
Sequence:CCGGGCTAGAATGTTTCAGGACATACTCGAGTATGTCCTGAAACATTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003478.3-1692s21c1
Sequence:CCGGAGCAGTTACTTACACTATTTACTCGAGTAAATAGTGTAAGTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003478.3-3242s21c1
Sequence:CCGGATTCATGAAGAGCCCATTATCCTCGAGGATAATGGGCTCTTCATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003478.3-1313s21c1
Sequence:CCGGACACAAGCACCCTCGTATTTACTCGAGTAAATACGAGGGTGCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003478.3-1768s21c1
Sequence:CCGGTGCAAGAGATAAGGCGTATAACTCGAGTTATACGCCTTATCTCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003478.2-675s1c1
Sequence:CCGGGCCATCAAGATGATACGGCTTCTCGAGAAGCCGTATCATCTTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006537    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003478.2-3887s1c1
Sequence:CCGGGCAGTAAACTTGCCAAATATACTCGAGTATATTTGGCAAGTTTACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003478.2-2632s1c1
Sequence:CCGGGCAGACTGAATTAGTAGAAATCTCGAGATTTCTACTAATTCAGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003478.2-2230s1c1
Sequence:CCGGCGCTGTATTGTTTGCATGGAACTCGAGTTCCATGCAAACAATACAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003478.2-1910s1c1
Sequence:CCGGGCTAGAATGTTTCAGGACATACTCGAGTATGTCCTGAAACATTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003478
VALIDATED
CUL5 MISSION shRNA shRNA Plasmid DNA
cullin 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003478.3-2147s21c1
Sequence:CCGGGCTAGAATGTTTCAGGACATACTCGAGTATGTCCTGAAACATTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003478.3-1692s21c1
Sequence:CCGGAGCAGTTACTTACACTATTTACTCGAGTAAATAGTGTAAGTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003478.3-3242s21c1
Sequence:CCGGATTCATGAAGAGCCCATTATCCTCGAGGATAATGGGCTCTTCATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003478.3-1313s21c1
Sequence:CCGGACACAAGCACCCTCGTATTTACTCGAGTAAATACGAGGGTGCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003478.3-1768s21c1
Sequence:CCGGTGCAAGAGATAAGGCGTATAACTCGAGTTATACGCCTTATCTCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003478.2-675s1c1
Sequence:CCGGGCCATCAAGATGATACGGCTTCTCGAGAAGCCGTATCATCTTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006537    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003478.2-3887s1c1
Sequence:CCGGGCAGTAAACTTGCCAAATATACTCGAGTATATTTGGCAAGTTTACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003478.2-2632s1c1
Sequence:CCGGGCAGACTGAATTAGTAGAAATCTCGAGATTTCTACTAATTCAGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003478.2-2230s1c1
Sequence:CCGGCGCTGTATTGTTTGCATGGAACTCGAGTTCCATGCAAACAATACAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003478.2-1910s1c1
Sequence:CCGGGCTAGAATGTTTCAGGACATACTCGAGTATGTCCTGAAACATTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003478
VALIDATED
CUL5 MISSION shRNA Lentiviral Transduction Particles
cullin 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003478.3-2147s21c1
Sequence:CCGGGCTAGAATGTTTCAGGACATACTCGAGTATGTCCTGAAACATTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003478.3-1692s21c1
Sequence:CCGGAGCAGTTACTTACACTATTTACTCGAGTAAATAGTGTAAGTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003478.3-3242s21c1
Sequence:CCGGATTCATGAAGAGCCCATTATCCTCGAGGATAATGGGCTCTTCATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003478.3-1313s21c1
Sequence:CCGGACACAAGCACCCTCGTATTTACTCGAGTAAATACGAGGGTGCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003478.3-1768s21c1
Sequence:CCGGTGCAAGAGATAAGGCGTATAACTCGAGTTATACGCCTTATCTCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003478.2-675s1c1
Sequence:CCGGGCCATCAAGATGATACGGCTTCTCGAGAAGCCGTATCATCTTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006537    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003478.2-3887s1c1
Sequence:CCGGGCAGTAAACTTGCCAAATATACTCGAGTATATTTGGCAAGTTTACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003478.2-2632s1c1
Sequence:CCGGGCAGACTGAATTAGTAGAAATCTCGAGATTTCTACTAATTCAGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003478.2-2230s1c1
Sequence:CCGGCGCTGTATTGTTTGCATGGAACTCGAGTTCCATGCAAACAATACAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003478.2-1910s1c1
Sequence:CCGGGCTAGAATGTTTCAGGACATACTCGAGTATGTCCTGAAACATTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027807
CUL5 MISSION shRNA Bacterial Glycerol Stock
cullin 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027807.1-2928s1c1
Sequence:CCGGCCCTTCATGTTGCACACTCTTCTCGAGAAGAGTGTGCAACATGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027807.1-958s1c1
Sequence:CCGGCGAGAGTCCTATGTTAATCTTCTCGAGAAGATTAACATAGGACTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027807.1-1638s1c1
Sequence:CCGGGCTTGCCAATTACTGTGACATCTCGAGATGTCACAGTAATTGGCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027807.1-2139s1c1
Sequence:CCGGCCATCTCATGTCAAATGGAATCTCGAGATTCCATTTGACATGAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027807.1-1519s1c1
Sequence:CCGGGCAAGAGATAAGGCATATAAACTCGAGTTTATATGCCTTATCTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027807
CUL5 MISSION shRNA shRNA Plasmid DNA
cullin 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027807.1-2928s1c1
Sequence:CCGGCCCTTCATGTTGCACACTCTTCTCGAGAAGAGTGTGCAACATGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027807.1-958s1c1
Sequence:CCGGCGAGAGTCCTATGTTAATCTTCTCGAGAAGATTAACATAGGACTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027807.1-1638s1c1
Sequence:CCGGGCTTGCCAATTACTGTGACATCTCGAGATGTCACAGTAATTGGCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027807.1-2139s1c1
Sequence:CCGGCCATCTCATGTCAAATGGAATCTCGAGATTCCATTTGACATGAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027807.1-1519s1c1
Sequence:CCGGGCAAGAGATAAGGCATATAAACTCGAGTTTATATGCCTTATCTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027807
CUL5 MISSION shRNA Lentiviral Transduction Particles
cullin 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027807.1-2928s1c1
Sequence:CCGGCCCTTCATGTTGCACACTCTTCTCGAGAAGAGTGTGCAACATGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027807.1-958s1c1
Sequence:CCGGCGAGAGTCCTATGTTAATCTTCTCGAGAAGATTAACATAGGACTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027807.1-1638s1c1
Sequence:CCGGGCTTGCCAATTACTGTGACATCTCGAGATGTCACAGTAATTGGCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027807.1-2139s1c1
Sequence:CCGGCCATCTCATGTCAAATGGAATCTCGAGATTCCATTTGACATGAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027807.1-1519s1c1
Sequence:CCGGGCAAGAGATAAGGCATATAAACTCGAGTTTATATGCCTTATCTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks