EMAIL THIS PAGE TO A FRIEND

CUL7

cullin 7

44 Gene Product Result for
Synonyms: KIAA0076 dJ20C7.5
UniProtKB ID: Q14999, B4DYZ0, F5H0L1, Q5T654
Gene ID:
Human(9820) Summary: The protein encoded by this gene is a component of an E3 ubiquitin-protein ligase complex. The encoded protein interacts with TP53, CUL9, and FBXW8 proteins. Defects in this gene are a cause of 3M syndrome type 1 (3M1). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
Mouse(66515) cullin 7
Rat(363191) cullin 7
dog(481807) cullin 7
Horse(100067262) cullin 7
cow(504558) cullin 7
sheep(101112931) cullin 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014780 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014780 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014780 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_358324 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_358324 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_358324 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025611 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025611 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025611 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014780 Rosetta Predictions human pricing
NM_025611 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014780 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152019 predicted 3799
2 SASI_Hs01_00152020 predicted 1394
3 SASI_Hs01_00152021 predicted 804
4 SASI_Hs01_00152022 predicted 3815
5 SASI_Hs01_00152024 predicted 2977
6 SASI_Hs01_00152025 predicted 348
7 SASI_Hs01_00152027 predicted 4915
8 SASI_Hs01_00152028 predicted 1976
9 SASI_Hs02_00346276 predicted 690
10 SASI_Hs02_00346277 predicted 4958
11 SASI_Hs01_00152023 predicted 2749
12 SASI_Hs01_00152026 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025611 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143178 predicted 613
2 SASI_Mm01_00143179 predicted 3972
3 SASI_Mm01_00143180 predicted 4999
4 SASI_Mm01_00143181 predicted 2540
5 SASI_Mm01_00143182 predicted 3059
6 SASI_Mm01_00143183 predicted 2074
7 SASI_Mm01_00143184 predicted 3806
8 SASI_Mm01_00143185 predicted 5102
9 SASI_Mm01_00143186 predicted 5285
10 SASI_Mm01_00143187 predicted 3825
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014780
VALIDATED
CUL7 MISSION shRNA Bacterial Glycerol Stock
cullin 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014780.2-3825s1c1
Sequence:CCGGCGCTACTGTGAGCACTTTAATCTCGAGATTAAAGTGCTCACAGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014780.2-4800s1c1
Sequence:CCGGGACATGCTCAATCAGGCGATTCTCGAGAATCGCCTGATTGAGCATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014780.2-1988s1c1
Sequence:CCGGCCTGATCAACTGCCATGTCTACTCGAGTAGACATGGCAGTTGATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014780.2-818s1c1
Sequence:CCGGCATGTTGAGTAGTCCTGATTACTCGAGTAATCAGGACTACTCAACATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014780.2-3338s1c1
Sequence:CCGGGCACCTGAGTTCTAGACTCAACTCGAGTTGAGTCTAGAACTCAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014780
VALIDATED
CUL7 MISSION shRNA shRNA Plasmid DNA
cullin 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014780.2-3825s1c1
Sequence:CCGGCGCTACTGTGAGCACTTTAATCTCGAGATTAAAGTGCTCACAGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014780.2-4800s1c1
Sequence:CCGGGACATGCTCAATCAGGCGATTCTCGAGAATCGCCTGATTGAGCATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014780.2-1988s1c1
Sequence:CCGGCCTGATCAACTGCCATGTCTACTCGAGTAGACATGGCAGTTGATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014780.2-818s1c1
Sequence:CCGGCATGTTGAGTAGTCCTGATTACTCGAGTAATCAGGACTACTCAACATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014780.2-3338s1c1
Sequence:CCGGGCACCTGAGTTCTAGACTCAACTCGAGTTGAGTCTAGAACTCAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014780
VALIDATED
CUL7 MISSION shRNA Lentiviral Transduction Particles
cullin 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014780.2-3825s1c1
Sequence:CCGGCGCTACTGTGAGCACTTTAATCTCGAGATTAAAGTGCTCACAGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014780.2-4800s1c1
Sequence:CCGGGACATGCTCAATCAGGCGATTCTCGAGAATCGCCTGATTGAGCATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014780.2-1988s1c1
Sequence:CCGGCCTGATCAACTGCCATGTCTACTCGAGTAGACATGGCAGTTGATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014780.2-818s1c1
Sequence:CCGGCATGTTGAGTAGTCCTGATTACTCGAGTAATCAGGACTACTCAACATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014780.2-3338s1c1
Sequence:CCGGGCACCTGAGTTCTAGACTCAACTCGAGTTGAGTCTAGAACTCAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_358324
CUL7 MISSION shRNA Bacterial Glycerol Stock
cullin 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358324.1-604s1c1
Sequence:CCGGGCGCTATTATAAAGGAACAATCTCGAGATTGTTCCTTTATAATAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358324.1-1229s1c1
Sequence:CCGGCTCGTCTATCTGGTGCTAGAACTCGAGTTCTAGCACCAGATAGACGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358324.1-1391s1c1
Sequence:CCGGCAGGTGCTGTACTATGCAGTTCTCGAGAACTGCATAGTACAGCACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358324.1-777s1c1
Sequence:CCGGGCTTAGAGAAAGAGCCACAGACTCGAGTCTGTGGCTCTTTCTCTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358324.1-1103s1c1
Sequence:CCGGCCTCAGACATACCTACAAGCTCTCGAGAGCTTGTAGGTATGTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_358324
CUL7 MISSION shRNA shRNA Plasmid DNA
cullin 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358324.1-604s1c1
Sequence:CCGGGCGCTATTATAAAGGAACAATCTCGAGATTGTTCCTTTATAATAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358324.1-1229s1c1
Sequence:CCGGCTCGTCTATCTGGTGCTAGAACTCGAGTTCTAGCACCAGATAGACGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358324.1-1391s1c1
Sequence:CCGGCAGGTGCTGTACTATGCAGTTCTCGAGAACTGCATAGTACAGCACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358324.1-777s1c1
Sequence:CCGGGCTTAGAGAAAGAGCCACAGACTCGAGTCTGTGGCTCTTTCTCTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358324.1-1103s1c1
Sequence:CCGGCCTCAGACATACCTACAAGCTCTCGAGAGCTTGTAGGTATGTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_358324
CUL7 MISSION shRNA Lentiviral Transduction Particles
cullin 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358324.1-604s1c1
Sequence:CCGGGCGCTATTATAAAGGAACAATCTCGAGATTGTTCCTTTATAATAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358324.1-1229s1c1
Sequence:CCGGCTCGTCTATCTGGTGCTAGAACTCGAGTTCTAGCACCAGATAGACGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358324.1-1391s1c1
Sequence:CCGGCAGGTGCTGTACTATGCAGTTCTCGAGAACTGCATAGTACAGCACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358324.1-777s1c1
Sequence:CCGGGCTTAGAGAAAGAGCCACAGACTCGAGTCTGTGGCTCTTTCTCTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358324.1-1103s1c1
Sequence:CCGGCCTCAGACATACCTACAAGCTCTCGAGAGCTTGTAGGTATGTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025611
CUL7 MISSION shRNA Bacterial Glycerol Stock
cullin 7
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025611.5-3806s21c1
Sequence:CCGGGTCCTGGAAAGACGATGATTTCTCGAGAAATCATCGTCTTTCCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025611.5-4669s21c1
Sequence:CCGGGCTTAGAGAAAGAGCCACAGACTCGAGTCTGTGGCTCTTTCTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025611.5-2543s21c1
Sequence:CCGGGGACTATGCGGTGATACTAAACTCGAGTTTAGTATCACCGCATAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025611.5-5283s21c1
Sequence:CCGGCAGGTGCTGTACTATGCAGTTCTCGAGAACTGCATAGTACAGCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025611.5-4995s21c1
Sequence:CCGGCCTCAGACATACCTACAAGCTCTCGAGAGCTTGTAGGTATGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025611.5-2103s21c1
Sequence:CCGGCCAGGTGCCCAGCCAAATTTACTCGAGTAAATTTGGCTGGGCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025611.5-3055s21c1
Sequence:CCGGACAGCATCAAGTCCGTTAATACTCGAGTATTAACGGACTTGATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025611.5-4265s21c1
Sequence:CCGGGCAGCGTCAGTTCCACGTTTACTCGAGTAAACGTGGAACTGACGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025611
CUL7 MISSION shRNA shRNA Plasmid DNA
cullin 7
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025611.5-3806s21c1
Sequence:CCGGGTCCTGGAAAGACGATGATTTCTCGAGAAATCATCGTCTTTCCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025611.5-4669s21c1
Sequence:CCGGGCTTAGAGAAAGAGCCACAGACTCGAGTCTGTGGCTCTTTCTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025611.5-2543s21c1
Sequence:CCGGGGACTATGCGGTGATACTAAACTCGAGTTTAGTATCACCGCATAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025611.5-5283s21c1
Sequence:CCGGCAGGTGCTGTACTATGCAGTTCTCGAGAACTGCATAGTACAGCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025611.5-4995s21c1
Sequence:CCGGCCTCAGACATACCTACAAGCTCTCGAGAGCTTGTAGGTATGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025611.5-2103s21c1
Sequence:CCGGCCAGGTGCCCAGCCAAATTTACTCGAGTAAATTTGGCTGGGCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025611.5-3055s21c1
Sequence:CCGGACAGCATCAAGTCCGTTAATACTCGAGTATTAACGGACTTGATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025611.5-4265s21c1
Sequence:CCGGGCAGCGTCAGTTCCACGTTTACTCGAGTAAACGTGGAACTGACGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025611
CUL7 MISSION shRNA Lentiviral Transduction Particles
cullin 7
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025611.5-3806s21c1
Sequence:CCGGGTCCTGGAAAGACGATGATTTCTCGAGAAATCATCGTCTTTCCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025611.5-4669s21c1
Sequence:CCGGGCTTAGAGAAAGAGCCACAGACTCGAGTCTGTGGCTCTTTCTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025611.5-2543s21c1
Sequence:CCGGGGACTATGCGGTGATACTAAACTCGAGTTTAGTATCACCGCATAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025611.5-5283s21c1
Sequence:CCGGCAGGTGCTGTACTATGCAGTTCTCGAGAACTGCATAGTACAGCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025611.5-4995s21c1
Sequence:CCGGCCTCAGACATACCTACAAGCTCTCGAGAGCTTGTAGGTATGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025611.5-2103s21c1
Sequence:CCGGCCAGGTGCCCAGCCAAATTTACTCGAGTAAATTTGGCTGGGCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025611.5-3055s21c1
Sequence:CCGGACAGCATCAAGTCCGTTAATACTCGAGTATTAACGGACTTGATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025611.5-4265s21c1
Sequence:CCGGGCAGCGTCAGTTCCACGTTTACTCGAGTAAACGTGGAACTGACGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks