EMAIL THIS PAGE TO A FRIEND

CUL9

cullin 9

155 Gene Product Result for
Synonyms: H7AP1 PARC RP3-330M21.2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015089 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015089 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015089 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081335 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081335 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081335 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015089 Rosetta Predictions human pricing
XM_001063728 Rosetta Predictions rat pricing
XM_236927 Rosetta Predictions rat pricing
NM_001081335 Rosetta Predictions mouse pricing
XM_355017 Rosetta Predictions mouse pricing
XM_895029 Rosetta Predictions mouse pricing
XM_902437 Rosetta Predictions mouse pricing
XM_902440 Rosetta Predictions mouse pricing
XM_902441 Rosetta Predictions mouse pricing
XM_902442 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015089 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075572 predicted 2132
2 SASI_Hs01_00075573 predicted 1346
3 SASI_Hs01_00075574 predicted 7350
4 SASI_Hs01_00075575 predicted 4314
5 SASI_Hs01_00075576 predicted 6068
6 SASI_Hs01_00075577 predicted 6843
7 SASI_Hs01_00075578 predicted 4562
8 SASI_Hs01_00075579 predicted 4583
9 SASI_Hs02_00346968 predicted 2149
10 SASI_Hs01_00075580 predicted 4553
11 SASI_Hs01_00075581 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063728 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00308120 predicted 6727
2 SASI_Rn02_00308121 predicted 6996
3 SASI_Rn02_00308122 predicted 2447
4 SASI_Rn02_00308123 predicted 3164
5 SASI_Rn02_00308124 predicted 4319
6 SASI_Rn02_00308125 predicted 1111
7 SASI_Rn02_00308126 predicted 3170
8 SASI_Rn02_00308127 predicted 3713
9 SASI_Rn02_00308128 predicted 2052
10 SASI_Rn02_00308129 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236927 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390504 predicted 6726
2 SASI_Rn02_00390505 predicted 6998
3 SASI_Rn02_00390506 predicted 2451
4 SASI_Rn02_00390507 predicted 3160
5 SASI_Rn02_00390508 predicted 4322
6 SASI_Rn02_00390509 predicted 1113
7 SASI_Rn02_00390510 predicted 3168
8 SASI_Rn02_00390511 predicted 3710
9 SASI_Rn02_00390512 predicted 2054
10 SASI_Rn02_00390513 predicted 232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081335 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297401 predicted 7181
2 SASI_Mm02_00297402 predicted 3576
3 SASI_Mm02_00297403 predicted 4499
4 SASI_Mm02_00297404 predicted 239
5 SASI_Mm02_00297405 predicted 7236
6 SASI_Mm02_00297406 predicted 5368
7 SASI_Mm02_00297407 predicted 4074
8 SASI_Mm02_00297408 predicted 1567
9 SASI_Mm02_00297409 predicted 2685
10 SASI_Mm02_00297410 predicted 4932
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355017 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00270298 predicted 7804
2 SASI_Mm01_00270299 predicted 6121
3 SASI_Mm01_00270300 predicted 7132
4 SASI_Mm01_00270301 predicted 7853
5 SASI_Mm01_00270302 predicted 5962
6 SASI_Mm01_00270303 predicted 7610
7 SASI_Mm01_00270304 predicted 5530
8 SASI_Mm01_00270305 predicted 5534
9 SASI_Mm01_00270306 predicted 7636
10 SASI_Mm01_00270307 predicted 7617
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895029 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00212900 predicted 7191
2 SASI_Mm01_00212901 predicted 3572
3 SASI_Mm01_00212902 predicted 4513
4 SASI_Mm01_00212903 predicted 247
5 SASI_Mm01_00212904 predicted 7243
6 SASI_Mm01_00212905 predicted 5376
7 SASI_Mm01_00212906 predicted 4084
8 SASI_Mm01_00212907 predicted 1570
9 SASI_Mm01_00212908 predicted 2687
10 SASI_Mm01_00212909 predicted 4941
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902437 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00270066 predicted 592
2 SASI_Mm01_00270067 predicted 672
3 SASI_Mm01_00270068 predicted 560
4 SASI_Mm01_00270069 predicted 599
5 SASI_Mm01_00270070 predicted 856
6 SASI_Mm01_00270071 predicted 608
7 SASI_Mm01_00270072 predicted 885
8 SASI_Mm01_00270073 predicted 594
9 SASI_Mm01_00270074 predicted 680
10 SASI_Mm01_00270075 predicted 572
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902440 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00267275 predicted 6177
2 SASI_Mm01_00267276 predicted 2011
3 SASI_Mm01_00267277 predicted 2581
4 SASI_Mm01_00267278 predicted 248
5 SASI_Mm01_00267279 predicted 6237
6 SASI_Mm01_00267280 predicted 4370
7 SASI_Mm01_00267281 predicted 3081
8 SASI_Mm01_00267282 predicted 1569
9 SASI_Mm01_00267283 predicted 3926
10 SASI_Mm01_00267284 predicted 3815
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902441 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00234032 predicted 2412
2 SASI_Mm01_00234033 predicted 2137
3 SASI_Mm01_00234034 predicted 2268
4 SASI_Mm01_00234035 predicted 755
5 SASI_Mm01_00234036 predicted 732
6 SASI_Mm01_00234037 predicted 467
7 SASI_Mm01_00234038 predicted 758
8 SASI_Mm01_00234039 predicted 2467
9 SASI_Mm01_00234040 predicted 606
10 SASI_Mm01_00234041 predicted 2449
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902442 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00256154 predicted 3695
2 SASI_Mm01_00256155 predicted 1019
3 SASI_Mm01_00256156 predicted 605
4 SASI_Mm01_00256157 predicted 1181
5 SASI_Mm01_00256158 predicted 3750
6 SASI_Mm01_00256159 predicted 1887
7 SASI_Mm01_00256160 predicted 596
8 SASI_Mm01_00256161 predicted 1445
9 SASI_Mm01_00256162 predicted 1338
10 SASI_Mm01_00256163 predicted 1449
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015089
CUL9 MISSION shRNA Bacterial Glycerol Stock
cullin 9
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015089.2-1817s21c1
Sequence:CCGGGCTCGTCTACTTCACGAAATCCTCGAGGATTTCGTGAAGTAGACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015089.2-4715s21c1
Sequence:CCGGAGCAGTTTGCCAGGTACATTGCTCGAGCAATGTACCTGGCAAACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015089.2-6947s21c1
Sequence:CCGGAGCGGTTTCAGGACTATAATGCTCGAGCATTATAGTCCTGAAACCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015089.2-1683s21c1
Sequence:CCGGGATCTCTGTGTCCGTGGAAATCTCGAGATTTCCACGGACACAGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015089.x-5181s1c1
Sequence:CCGGCCTTGACCGTTTCTCCAGTTTCTCGAGAAACTGGAGAAACGGTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015089.x-1007s1c1
Sequence:CCGGCCATCTTTCAGCCCTACATTTCTCGAGAAATGTAGGGCTGAAAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015089.x-6287s1c1
Sequence:CCGGGCTGGAATGAGTACCTGACAACTCGAGTTGTCAGGTACTCATTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015089.x-1644s1c1
Sequence:CCGGGCAGGTTCTCAGTAGTCGATTCTCGAGAATCGACTACTGAGAACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015089.x-7649s1c1
Sequence:CCGGTCTGTAGTGCTTCCTGTTTGCCTCGAGGCAAACAGGAAGCACTACAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015089
CUL9 MISSION shRNA shRNA Plasmid DNA
cullin 9
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015089.2-1817s21c1
Sequence:CCGGGCTCGTCTACTTCACGAAATCCTCGAGGATTTCGTGAAGTAGACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015089.2-4715s21c1
Sequence:CCGGAGCAGTTTGCCAGGTACATTGCTCGAGCAATGTACCTGGCAAACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015089.2-6947s21c1
Sequence:CCGGAGCGGTTTCAGGACTATAATGCTCGAGCATTATAGTCCTGAAACCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015089.2-1683s21c1
Sequence:CCGGGATCTCTGTGTCCGTGGAAATCTCGAGATTTCCACGGACACAGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015089.x-5181s1c1
Sequence:CCGGCCTTGACCGTTTCTCCAGTTTCTCGAGAAACTGGAGAAACGGTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015089.x-1007s1c1
Sequence:CCGGCCATCTTTCAGCCCTACATTTCTCGAGAAATGTAGGGCTGAAAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015089.x-6287s1c1
Sequence:CCGGGCTGGAATGAGTACCTGACAACTCGAGTTGTCAGGTACTCATTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015089.x-1644s1c1
Sequence:CCGGGCAGGTTCTCAGTAGTCGATTCTCGAGAATCGACTACTGAGAACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015089.x-7649s1c1
Sequence:CCGGTCTGTAGTGCTTCCTGTTTGCCTCGAGGCAAACAGGAAGCACTACAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015089
CUL9 MISSION shRNA Lentiviral Transduction Particles
cullin 9
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015089.2-1817s21c1
Sequence:CCGGGCTCGTCTACTTCACGAAATCCTCGAGGATTTCGTGAAGTAGACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015089.2-4715s21c1
Sequence:CCGGAGCAGTTTGCCAGGTACATTGCTCGAGCAATGTACCTGGCAAACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015089.2-6947s21c1
Sequence:CCGGAGCGGTTTCAGGACTATAATGCTCGAGCATTATAGTCCTGAAACCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015089.2-1683s21c1
Sequence:CCGGGATCTCTGTGTCCGTGGAAATCTCGAGATTTCCACGGACACAGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015089.x-5181s1c1
Sequence:CCGGCCTTGACCGTTTCTCCAGTTTCTCGAGAAACTGGAGAAACGGTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015089.x-1007s1c1
Sequence:CCGGCCATCTTTCAGCCCTACATTTCTCGAGAAATGTAGGGCTGAAAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015089.x-6287s1c1
Sequence:CCGGGCTGGAATGAGTACCTGACAACTCGAGTTGTCAGGTACTCATTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015089.x-1644s1c1
Sequence:CCGGGCAGGTTCTCAGTAGTCGATTCTCGAGAATCGACTACTGAGAACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015089.x-7649s1c1
Sequence:CCGGTCTGTAGTGCTTCCTGTTTGCCTCGAGGCAAACAGGAAGCACTACAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081335
CUL9 MISSION shRNA Bacterial Glycerol Stock
cullin 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081335.1-2443s21c1
Sequence:CCGGATGAATGGCGTCCGCTCTTTGCTCGAGCAAAGAGCGGACGCCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081335.1-4070s21c1
Sequence:CCGGATTGTTCCGGGAGCAACTATGCTCGAGCATAGTTGCTCCCGGAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081335.1-1268s21c1
Sequence:CCGGCCGCAGCGGTTATGGTGAATACTCGAGTATTCACCATAACCGCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081335.1-6541s21c1
Sequence:CCGGGAGCCTTCATCCGTAACATTGCTCGAGCAATGTTACGGATGAAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081335.1-1063s21c1
Sequence:CCGGTGGCCGTGGGCAATCTCATTTCTCGAGAAATGAGATTGCCCACGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081335
CUL9 MISSION shRNA shRNA Plasmid DNA
cullin 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081335.1-2443s21c1
Sequence:CCGGATGAATGGCGTCCGCTCTTTGCTCGAGCAAAGAGCGGACGCCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081335.1-4070s21c1
Sequence:CCGGATTGTTCCGGGAGCAACTATGCTCGAGCATAGTTGCTCCCGGAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081335.1-1268s21c1
Sequence:CCGGCCGCAGCGGTTATGGTGAATACTCGAGTATTCACCATAACCGCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081335.1-6541s21c1
Sequence:CCGGGAGCCTTCATCCGTAACATTGCTCGAGCAATGTTACGGATGAAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081335.1-1063s21c1
Sequence:CCGGTGGCCGTGGGCAATCTCATTTCTCGAGAAATGAGATTGCCCACGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081335
CUL9 MISSION shRNA Lentiviral Transduction Particles
cullin 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081335.1-2443s21c1
Sequence:CCGGATGAATGGCGTCCGCTCTTTGCTCGAGCAAAGAGCGGACGCCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081335.1-4070s21c1
Sequence:CCGGATTGTTCCGGGAGCAACTATGCTCGAGCATAGTTGCTCCCGGAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081335.1-1268s21c1
Sequence:CCGGCCGCAGCGGTTATGGTGAATACTCGAGTATTCACCATAACCGCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081335.1-6541s21c1
Sequence:CCGGGAGCCTTCATCCGTAACATTGCTCGAGCAATGTTACGGATGAAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081335.1-1063s21c1
Sequence:CCGGTGGCCGTGGGCAATCTCATTTCTCGAGAAATGAGATTGCCCACGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks