EMAIL THIS PAGE TO A FRIEND

CUTA

cutA divalent cation tolerance homolog (E. coli)

Synonyms: ACHAP C6orf82
Gene ID:
Mouse(67675) cutA divalent cation tolerance homolog (E. coli)
Rat(294288) cutA divalent cation tolerance homolog (E. coli)
Thale Cress(817940) protein CutA
dog(474874) cutA divalent cation tolerance homolog (E. coli)
cow(508956) cutA divalent cation tolerance homolog (E. coli)
domestic cat(101092684) cutA divalent cation tolerance homolog (E. coli)
chicken(417124) cutA divalent cation tolerance homolog (E. coli)
domestic guinea pig(100735114) cutA divalent cation tolerance homolog (E. coli)
naked mole-rat(101708878) cutA divalent cation tolerance homolog (E. coli)
sheep(101114061) cutA divalent cation tolerance homolog (E. coli)
110 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015921 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015921 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015921 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026307 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026307 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026307 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014433 Rosetta Predictions human pricing
NM_001014837 Rosetta Predictions human pricing
NM_001014838 Rosetta Predictions human pricing
NM_001014840 Rosetta Predictions human pricing
NM_015921 Rosetta Predictions human pricing
NM_212494 Rosetta Predictions rat pricing
NM_026307 Rosetta Predictions mouse pricing
NM_026948 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014433 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076852 predicted 460
2 SASI_Hs01_00076853 predicted 433
3 SASI_Hs01_00076854 predicted 507
4 SASI_Hs01_00076856 predicted 450
5 SASI_Hs01_00076857 predicted 507
6 SASI_Hs02_00306537 predicted 546
7 SASI_Hs01_00076858 predicted 428
8 SASI_Hs02_00306538 predicted 447
9 SASI_Hs01_00076859 predicted 581
10 SASI_Hs01_00076860 predicted 468
11 SASI_Hs01_00076855 predicted 448
12 SASI_Hs01_00076861 predicted 463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014837 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037469 predicted 704
2 SASI_Hs01_00037470 predicted 680
3 SASI_Hs01_00037471 predicted 756
4 SASI_Hs01_00037473 predicted 700
5 SASI_Hs01_00037474 predicted 760
6 SASI_Hs02_00306584 predicted 796
7 SASI_Hs01_00037475 predicted 674
8 SASI_Hs02_00306585 predicted 697
9 SASI_Hs01_00037476 predicted 832
10 SASI_Hs01_00037477 predicted 720
11 SASI_Hs01_00037472 predicted 703
12 SASI_Hs01_00037478 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014838 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183170 predicted 673
2 SASI_Hs01_00183171 predicted 647
3 SASI_Hs01_00183172 predicted 721
4 SASI_Hs01_00183174 predicted 669
5 SASI_Hs01_00183175 predicted 726
6 SASI_Hs02_00306586 predicted 764
7 SASI_Hs01_00183176 predicted 648
8 SASI_Hs02_00306587 predicted 662
9 SASI_Hs01_00183177 predicted 802
10 SASI_Hs01_00183178 predicted 693
11 SASI_Hs01_00183173 predicted 673
12 SASI_Hs01_00183179 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014840 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209486 predicted 589
2 SASI_Hs01_00209487 predicted 559
3 SASI_Hs01_00209488 predicted 635
4 SASI_Hs01_00209490 predicted 579
5 SASI_Hs01_00209491 predicted 641
6 SASI_Hs02_00306590 predicted 675
7 SASI_Hs01_00209492 predicted 553
8 SASI_Hs02_00306591 predicted 578
9 SASI_Hs01_00209493 predicted 709
10 SASI_Hs01_00209494 predicted 600
11 SASI_Hs01_00209489 predicted 576
12 SASI_Hs01_00209495 predicted 593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015921 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029438 predicted 847
2 SASI_Hs01_00029439 predicted 820
3 SASI_Hs01_00029440 predicted 898
4 SASI_Hs01_00029442 predicted 847
5 SASI_Hs01_00029443 predicted 897
6 SASI_Hs02_00348542 predicted 930
7 SASI_Hs01_00029444 predicted 817
8 SASI_Hs02_00348543 predicted 844
9 SASI_Hs01_00029445 predicted 970
10 SASI_Hs01_00029446 predicted 868
11 SASI_Hs01_00029441 predicted 837
12 SASI_Hs01_00029447 predicted 850
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212494 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068663 predicted 432
2 SASI_Rn01_00068664 predicted 275
3 SASI_Rn01_00068665 predicted 289
4 SASI_Rn01_00068666 predicted 474
5 SASI_Rn01_00068667 predicted 416
6 SASI_Rn01_00068668 predicted 379
7 SASI_Rn01_00068669 predicted 366
8 SASI_Rn01_00068670 predicted 300
9 SASI_Rn01_00068671 predicted 327
10 SASI_Rn01_00068672 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026307 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191203 predicted 415
2 SASI_Mm02_00330005 predicted 415
3 SASI_Mm01_00191205 predicted 291
4 SASI_Mm01_00191206 predicted 279
5 SASI_Mm01_00191208 predicted 325
6 SASI_Mm01_00191209 predicted 305
7 SASI_Mm02_00330006 predicted 290
8 SASI_Mm01_00191210 predicted 403
9 SASI_Mm02_00330007 predicted 408
10 SASI_Mm02_00330008 predicted 362
11 SASI_Mm01_00191202 predicted 368
12 SASI_Mm01_00191204 predicted 405
13 SASI_Mm01_00191207 predicted 318
14 SASI_Mm01_00191211 predicted 279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026948 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091821 predicted 376
2 SASI_Mm01_00091822 predicted 370
3 SASI_Mm02_00331261 predicted 362
4 SASI_Mm01_00091823 predicted 245
5 SASI_Mm02_00331262 predicted 237
6 SASI_Mm01_00091825 predicted 281
7 SASI_Mm01_00091826 predicted 258
8 SASI_Mm01_00091827 predicted 253
9 SASI_Mm01_00091828 predicted 365
10 SASI_Mm01_00091829 predicted 367
11 SASI_Mm01_00091824 predicted 277
12 SASI_Mm01_00091830 predicted 278
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015921
VALIDATED
CUTA MISSION shRNA Bacterial Glycerol Stock
cutA divalent cation tolerance homolog (E. coli)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015921.2-852s1c1
Sequence:CCGGCCTCAGATTACATCCATCTATCTCGAGATAGATGGATGTAATCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015921.2-993s1c1
Sequence:CCGGGTAATTGCATTGCCTGTGGAACTCGAGTTCCACAGGCAATGCAATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015921.2-903s1c1
Sequence:CCGGGAGGTGCTGATGATGATTAAACTCGAGTTTAATCATCATCAGCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015921.2-1054s1c1
Sequence:CCGGCAGAGTCAGTTTCTGACTCTACTCGAGTAGAGTCAGAAACTGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_015921.2-853s21c1
Sequence:CCGGCTCAGATTACATCCATCTATGCTCGAGCATAGATGGATGTAATCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_015921.2-938s21c1
Sequence:CCGGGGTCCCAGCTTTGACAGATTTCTCGAGAAATCTGTCAAAGCTGGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_015921.2-978s21c1
Sequence:CCGGTACGAAGTGGCCGAGGTAATTCTCGAGAATTACCTCGGCCACTTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015921.2-901s21c1
Sequence:CCGGGTGAGGTGCTGATGATGATTACTCGAGTAATCATCATCAGCACCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_015921.2-752s21c1
Sequence:CCGGGGTCTCTGCAGCCTTTGTTACCTCGAGGTAACAAAGGCTGCAGAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015921
VALIDATED
CUTA MISSION shRNA shRNA Plasmid DNA
cutA divalent cation tolerance homolog (E. coli)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015921.2-852s1c1
Sequence:CCGGCCTCAGATTACATCCATCTATCTCGAGATAGATGGATGTAATCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015921.2-993s1c1
Sequence:CCGGGTAATTGCATTGCCTGTGGAACTCGAGTTCCACAGGCAATGCAATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015921.2-903s1c1
Sequence:CCGGGAGGTGCTGATGATGATTAAACTCGAGTTTAATCATCATCAGCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015921.2-1054s1c1
Sequence:CCGGCAGAGTCAGTTTCTGACTCTACTCGAGTAGAGTCAGAAACTGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_015921.2-853s21c1
Sequence:CCGGCTCAGATTACATCCATCTATGCTCGAGCATAGATGGATGTAATCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_015921.2-938s21c1
Sequence:CCGGGGTCCCAGCTTTGACAGATTTCTCGAGAAATCTGTCAAAGCTGGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_015921.2-978s21c1
Sequence:CCGGTACGAAGTGGCCGAGGTAATTCTCGAGAATTACCTCGGCCACTTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015921.2-901s21c1
Sequence:CCGGGTGAGGTGCTGATGATGATTACTCGAGTAATCATCATCAGCACCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_015921.2-752s21c1
Sequence:CCGGGGTCTCTGCAGCCTTTGTTACCTCGAGGTAACAAAGGCTGCAGAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015921
VALIDATED
CUTA MISSION shRNA Lentiviral Transduction Particles
cutA divalent cation tolerance homolog (E. coli)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015921.2-852s1c1
Sequence:CCGGCCTCAGATTACATCCATCTATCTCGAGATAGATGGATGTAATCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015921.2-993s1c1
Sequence:CCGGGTAATTGCATTGCCTGTGGAACTCGAGTTCCACAGGCAATGCAATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015921.2-903s1c1
Sequence:CCGGGAGGTGCTGATGATGATTAAACTCGAGTTTAATCATCATCAGCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015921.2-1054s1c1
Sequence:CCGGCAGAGTCAGTTTCTGACTCTACTCGAGTAGAGTCAGAAACTGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_015921.2-853s21c1
Sequence:CCGGCTCAGATTACATCCATCTATGCTCGAGCATAGATGGATGTAATCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_015921.2-938s21c1
Sequence:CCGGGGTCCCAGCTTTGACAGATTTCTCGAGAAATCTGTCAAAGCTGGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_015921.2-978s21c1
Sequence:CCGGTACGAAGTGGCCGAGGTAATTCTCGAGAATTACCTCGGCCACTTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015921.2-901s21c1
Sequence:CCGGGTGAGGTGCTGATGATGATTACTCGAGTAATCATCATCAGCACCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_015921.2-752s21c1
Sequence:CCGGGGTCTCTGCAGCCTTTGTTACCTCGAGGTAACAAAGGCTGCAGAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026307
VALIDATED
CUTA MISSION shRNA Bacterial Glycerol Stock
cutA divalent cation tolerance homolog (E. coli)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026307.2-337s1c1
Sequence:CCGGCATCTATGAATGGAAAGGAAACTCGAGTTTCCTTTCCATTCATAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026307.2-521s1c1
Sequence:CCGGGTCACAGAATCGGTTTCAAATCTCGAGATTTGAAACCGATTCTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026307.2-434s1c1
Sequence:CCGGCGATCTGTGCACCCTTATGAACTCGAGTTCATAAGGGTGCACAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026307.2-150s1c1
Sequence:CCGGTGCTGTCAATGGCTTCTGGAACTCGAGTTCCAGAAGCCATTGACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026307.2-331s1c1
Sequence:CCGGCACATCCATCTATGAATGGAACTCGAGTTCCATTCATAGATGGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026307.2-521s21c1
Sequence:CCGGGTCACAGAATCGGTTTCAAATCTCGAGATTTGAAACCGATTCTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026307.2-331s21c1
Sequence:CCGGCACATCCATCTATGAATGGAACTCGAGTTCCATTCATAGATGGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026307.2-434s21c1
Sequence:CCGGCGATCTGTGCACCCTTATGAACTCGAGTTCATAAGGGTGCACAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026307.2-150s21c1
Sequence:CCGGTGCTGTCAATGGCTTCTGGAACTCGAGTTCCAGAAGCCATTGACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026307
VALIDATED
CUTA MISSION shRNA shRNA Plasmid DNA
cutA divalent cation tolerance homolog (E. coli)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026307.2-337s1c1
Sequence:CCGGCATCTATGAATGGAAAGGAAACTCGAGTTTCCTTTCCATTCATAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026307.2-521s1c1
Sequence:CCGGGTCACAGAATCGGTTTCAAATCTCGAGATTTGAAACCGATTCTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026307.2-434s1c1
Sequence:CCGGCGATCTGTGCACCCTTATGAACTCGAGTTCATAAGGGTGCACAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026307.2-150s1c1
Sequence:CCGGTGCTGTCAATGGCTTCTGGAACTCGAGTTCCAGAAGCCATTGACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026307.2-331s1c1
Sequence:CCGGCACATCCATCTATGAATGGAACTCGAGTTCCATTCATAGATGGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026307.2-521s21c1
Sequence:CCGGGTCACAGAATCGGTTTCAAATCTCGAGATTTGAAACCGATTCTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026307.2-331s21c1
Sequence:CCGGCACATCCATCTATGAATGGAACTCGAGTTCCATTCATAGATGGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026307.2-434s21c1
Sequence:CCGGCGATCTGTGCACCCTTATGAACTCGAGTTCATAAGGGTGCACAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026307.2-150s21c1
Sequence:CCGGTGCTGTCAATGGCTTCTGGAACTCGAGTTCCAGAAGCCATTGACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026307
VALIDATED
CUTA MISSION shRNA Lentiviral Transduction Particles
cutA divalent cation tolerance homolog (E. coli)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026307.2-337s1c1
Sequence:CCGGCATCTATGAATGGAAAGGAAACTCGAGTTTCCTTTCCATTCATAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026307.2-521s1c1
Sequence:CCGGGTCACAGAATCGGTTTCAAATCTCGAGATTTGAAACCGATTCTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026307.2-434s1c1
Sequence:CCGGCGATCTGTGCACCCTTATGAACTCGAGTTCATAAGGGTGCACAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026307.2-150s1c1
Sequence:CCGGTGCTGTCAATGGCTTCTGGAACTCGAGTTCCAGAAGCCATTGACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026307.2-331s1c1
Sequence:CCGGCACATCCATCTATGAATGGAACTCGAGTTCCATTCATAGATGGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026307.2-521s21c1
Sequence:CCGGGTCACAGAATCGGTTTCAAATCTCGAGATTTGAAACCGATTCTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026307.2-331s21c1
Sequence:CCGGCACATCCATCTATGAATGGAACTCGAGTTCCATTCATAGATGGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026307.2-434s21c1
Sequence:CCGGCGATCTGTGCACCCTTATGAACTCGAGTTCATAAGGGTGCACAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026307.2-150s21c1
Sequence:CCGGTGCTGTCAATGGCTTCTGGAACTCGAGTTCCAGAAGCCATTGACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks