EMAIL THIS PAGE TO A FRIEND

CUTC

cutC copper transporter

Synonyms: RP11-483F11.3
UniProtKB ID: Q9NTM9, Q5TCZ8, Q9Y321
Gene ID:
Human(51076) Summary: Members of the CUT family of copper transporters are associated with copper homeostasis and are involved in the uptake, storage, delivery, and efflux of copper (Gupta et al., 1995 [PubMed 7635807]
Mouse(66388) cutC copper transporter homolog (E.coli)
Rat(361760) cutC copper transporter
sheep(101119521) cutC copper transporter homolog (E. coli)
naked mole-rat(101715036) cutC copper transporter homolog (E. coli)
domestic guinea pig(100718557) cutC copper transporter homolog (E. coli)
Zebrafish(450025) cutC copper transporter homolog (E. coli)
cow(535065) cutC copper transporter homolog (E. coli)
domestic cat(101085663) cutC copper transporter homolog (E. coli)
dog(477793) cutC copper transporter homolog (E. coli)
chicken(423829) cutC copper transporter homolog (E. coli)
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015960 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015960 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015960 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025530 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025530 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025530 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015960 Rosetta Predictions human pricing
NM_001108525 Rosetta Predictions rat pricing
NM_001113562 Rosetta Predictions mouse pricing
NM_025530 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015960 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147802 predicted 517
2 SASI_Hs01_00147803 predicted 807
3 SASI_Hs02_00348617 predicted 449
4 SASI_Hs02_00348618 predicted 465
5 SASI_Hs01_00147804 predicted 747
6 SASI_Hs01_00147805 predicted 417
7 SASI_Hs01_00147806 predicted 738
8 SASI_Hs02_00348619 predicted 218
9 SASI_Hs01_00147808 predicted 803
10 SASI_Hs02_00348620 predicted 222
11 SASI_Hs01_00147807 predicted 421
12 SASI_Hs01_00147809 predicted 974
13 SASI_Hs01_00147810 predicted 856
14 SASI_Hs01_00147811 predicted 906
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108525 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239509 predicted 501
2 SASI_Rn02_00239510 predicted 990
3 SASI_Rn02_00239511 predicted 519
4 SASI_Rn02_00239512 predicted 911
5 SASI_Rn02_00239513 predicted 934
6 SASI_Rn02_00239514 predicted 824
7 SASI_Rn02_00239515 predicted 938
8 SASI_Rn02_00239516 predicted 292
9 SASI_Rn02_00239517 predicted 755
10 SASI_Rn02_00239518 predicted 789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113562 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308209 predicted 1031
2 SASI_Mm02_00308210 predicted 324
3 SASI_Mm02_00308211 predicted 947
4 SASI_Mm02_00308212 predicted 1015
5 SASI_Mm02_00308213 predicted 824
6 SASI_Mm02_00308214 predicted 1041
7 SASI_Mm02_00308215 predicted 917
8 SASI_Mm02_00308216 predicted 915
9 SASI_Mm02_00308217 predicted 317
10 SASI_Mm02_00308218 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025530 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328447 predicted 1006
2 SASI_Mm02_00328448 predicted 325
3 SASI_Mm02_00328449 predicted 916
4 SASI_Mm02_00328450 predicted 990
5 SASI_Mm01_00064269 predicted 794
6 SASI_Mm02_00328451 predicted 1014
7 SASI_Mm02_00328452 predicted 894
8 SASI_Mm01_00064271 predicted 884
9 SASI_Mm02_00328453 predicted 317
10 SASI_Mm01_00064272 predicted 313
11 SASI_Mm01_00064270 predicted 930
12 SASI_Mm01_00064273 predicted 1043
13 SASI_Mm01_00064274 predicted 479
14 SASI_Mm01_00064275 predicted 683
15 SASI_Mm01_00064276 predicted 876
16 SASI_Mm01_00064277 predicted 427
17 SASI_Mm01_00064278 predicted 533
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015960
VALIDATED
CUTC MISSION shRNA Bacterial Glycerol Stock
cutC copper transporter
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015960.1-538s1c1
Sequence:CCGGCGAGCCTTTGACATGGTTCATCTCGAGATGAACCATGTCAAAGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015960.1-876s1c1
Sequence:CCGGGACCAAAGTAAGGACTTTGAACTCGAGTTCAAAGTCCTTACTTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_015960.1-473s1c1
Sequence:CCGGACATTGACAAAGAGCTGTGTACTCGAGTACACAGCTCTTTGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015960.1-304s1c1
Sequence:CCGGCAAGTAGTGAAGCAGAGTGTTCTCGAGAACACTCTGCTTCACTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015960.1-239s1c1
Sequence:CCGGCTGATCGGATTGAATTATGTTCTCGAGAACATAATTCAATCCGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_015960.2-1175s21c1
Sequence:CCGGGTGATTGTCATCATGGTTAAACTCGAGTTTAACCATGATGACAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_015960.2-922s21c1
Sequence:CCGGGACCAAAGTAAGGACTTTGAACTCGAGTTCAAAGTCCTTACTTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015960.2-285s21c1
Sequence:CCGGCTGATCGGATTGAATTATGTTCTCGAGAACATAATTCAATCCGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_015960.2-350s21c1
Sequence:CCGGCAAGTAGTGAAGCAGAGTGTTCTCGAGAACACTCTGCTTCACTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_015960.2-741s21c1
Sequence:CCGGTAATGCCAGGAGGTGGTATAACTCGAGTTATACCACCTCCTGGCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015960
VALIDATED
CUTC MISSION shRNA shRNA Plasmid DNA
cutC copper transporter
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015960.1-538s1c1
Sequence:CCGGCGAGCCTTTGACATGGTTCATCTCGAGATGAACCATGTCAAAGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015960.1-876s1c1
Sequence:CCGGGACCAAAGTAAGGACTTTGAACTCGAGTTCAAAGTCCTTACTTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_015960.1-473s1c1
Sequence:CCGGACATTGACAAAGAGCTGTGTACTCGAGTACACAGCTCTTTGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015960.1-304s1c1
Sequence:CCGGCAAGTAGTGAAGCAGAGTGTTCTCGAGAACACTCTGCTTCACTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015960.1-239s1c1
Sequence:CCGGCTGATCGGATTGAATTATGTTCTCGAGAACATAATTCAATCCGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_015960.2-1175s21c1
Sequence:CCGGGTGATTGTCATCATGGTTAAACTCGAGTTTAACCATGATGACAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_015960.2-922s21c1
Sequence:CCGGGACCAAAGTAAGGACTTTGAACTCGAGTTCAAAGTCCTTACTTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015960.2-285s21c1
Sequence:CCGGCTGATCGGATTGAATTATGTTCTCGAGAACATAATTCAATCCGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_015960.2-350s21c1
Sequence:CCGGCAAGTAGTGAAGCAGAGTGTTCTCGAGAACACTCTGCTTCACTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_015960.2-741s21c1
Sequence:CCGGTAATGCCAGGAGGTGGTATAACTCGAGTTATACCACCTCCTGGCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015960
VALIDATED
CUTC MISSION shRNA Lentiviral Transduction Particles
cutC copper transporter
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015960.1-538s1c1
Sequence:CCGGCGAGCCTTTGACATGGTTCATCTCGAGATGAACCATGTCAAAGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015960.1-876s1c1
Sequence:CCGGGACCAAAGTAAGGACTTTGAACTCGAGTTCAAAGTCCTTACTTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_015960.1-473s1c1
Sequence:CCGGACATTGACAAAGAGCTGTGTACTCGAGTACACAGCTCTTTGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015960.1-304s1c1
Sequence:CCGGCAAGTAGTGAAGCAGAGTGTTCTCGAGAACACTCTGCTTCACTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015960.1-239s1c1
Sequence:CCGGCTGATCGGATTGAATTATGTTCTCGAGAACATAATTCAATCCGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_015960.2-1175s21c1
Sequence:CCGGGTGATTGTCATCATGGTTAAACTCGAGTTTAACCATGATGACAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_015960.2-922s21c1
Sequence:CCGGGACCAAAGTAAGGACTTTGAACTCGAGTTCAAAGTCCTTACTTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015960.2-285s21c1
Sequence:CCGGCTGATCGGATTGAATTATGTTCTCGAGAACATAATTCAATCCGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_015960.2-350s21c1
Sequence:CCGGCAAGTAGTGAAGCAGAGTGTTCTCGAGAACACTCTGCTTCACTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_015960.2-741s21c1
Sequence:CCGGTAATGCCAGGAGGTGGTATAACTCGAGTTATACCACCTCCTGGCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025530
VALIDATED
CUTC MISSION shRNA Bacterial Glycerol Stock
cutC copper transporter
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070203    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025530.1-1021s1c1
Sequence:CCGGCGAAGCTCTAACCTTTCACATCTCGAGATGTGAAAGGTTAGAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025530.1-678s1c1
Sequence:CCGGGCCTCTAATAAAGCAACTCATCTCGAGATGAGTTGCTTTATTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025530.1-551s1c1
Sequence:CCGGGCTTGTCTCTTGTAGCTCTTTCTCGAGAAAGAGCTACAAGAGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025530.1-241s1c1
Sequence:CCGGCTTATGGAAGTGTGTGTAGATCTCGAGATCTACACACACTTCCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025530.1-913s1c1
Sequence:CCGGGTAAGGACTTTGAATGCAATTCTCGAGAATTGCATTCAAAGTCCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025530.3-389s21c1
Sequence:CCGGACGCGGAGGCGACTTCTTATACTCGAGTATAAGAAGTCGCCTCCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025530.3-888s21c1
Sequence:CCGGGTAAGGACTTTGAATGCAATTCTCGAGAATTGCATTCAAAGTCCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025530.3-526s21c1
Sequence:CCGGGCTTGTCTCTTGTAGCTCTTTCTCGAGAAAGAGCTACAAGAGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025530.3-996s21c1
Sequence:CCGGCGAAGCTCTAACCTTTCACATCTCGAGATGTGAAAGGTTAGAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025530.3-800s21c1
Sequence:CCGGAGGAATGAAGTTTCGAAATTCCTCGAGGAATTTCGAAACTTCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025530
VALIDATED
CUTC MISSION shRNA shRNA Plasmid DNA
cutC copper transporter
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070203    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025530.1-1021s1c1
Sequence:CCGGCGAAGCTCTAACCTTTCACATCTCGAGATGTGAAAGGTTAGAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025530.1-678s1c1
Sequence:CCGGGCCTCTAATAAAGCAACTCATCTCGAGATGAGTTGCTTTATTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025530.1-551s1c1
Sequence:CCGGGCTTGTCTCTTGTAGCTCTTTCTCGAGAAAGAGCTACAAGAGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025530.1-241s1c1
Sequence:CCGGCTTATGGAAGTGTGTGTAGATCTCGAGATCTACACACACTTCCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025530.1-913s1c1
Sequence:CCGGGTAAGGACTTTGAATGCAATTCTCGAGAATTGCATTCAAAGTCCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025530.3-389s21c1
Sequence:CCGGACGCGGAGGCGACTTCTTATACTCGAGTATAAGAAGTCGCCTCCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025530.3-888s21c1
Sequence:CCGGGTAAGGACTTTGAATGCAATTCTCGAGAATTGCATTCAAAGTCCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025530.3-526s21c1
Sequence:CCGGGCTTGTCTCTTGTAGCTCTTTCTCGAGAAAGAGCTACAAGAGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025530.3-996s21c1
Sequence:CCGGCGAAGCTCTAACCTTTCACATCTCGAGATGTGAAAGGTTAGAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025530.3-800s21c1
Sequence:CCGGAGGAATGAAGTTTCGAAATTCCTCGAGGAATTTCGAAACTTCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025530
VALIDATED
CUTC MISSION shRNA Lentiviral Transduction Particles
cutC copper transporter
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070203    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025530.1-1021s1c1
Sequence:CCGGCGAAGCTCTAACCTTTCACATCTCGAGATGTGAAAGGTTAGAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025530.1-678s1c1
Sequence:CCGGGCCTCTAATAAAGCAACTCATCTCGAGATGAGTTGCTTTATTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025530.1-551s1c1
Sequence:CCGGGCTTGTCTCTTGTAGCTCTTTCTCGAGAAAGAGCTACAAGAGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025530.1-241s1c1
Sequence:CCGGCTTATGGAAGTGTGTGTAGATCTCGAGATCTACACACACTTCCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025530.1-913s1c1
Sequence:CCGGGTAAGGACTTTGAATGCAATTCTCGAGAATTGCATTCAAAGTCCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025530.3-389s21c1
Sequence:CCGGACGCGGAGGCGACTTCTTATACTCGAGTATAAGAAGTCGCCTCCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025530.3-888s21c1
Sequence:CCGGGTAAGGACTTTGAATGCAATTCTCGAGAATTGCATTCAAAGTCCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025530.3-526s21c1
Sequence:CCGGGCTTGTCTCTTGTAGCTCTTTCTCGAGAAAGAGCTACAAGAGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025530.3-996s21c1
Sequence:CCGGCGAAGCTCTAACCTTTCACATCTCGAGATGTGAAAGGTTAGAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025530.3-800s21c1
Sequence:CCGGAGGAATGAAGTTTCGAAATTCCTCGAGGAATTTCGAAACTTCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks