EMAIL THIS PAGE TO A FRIEND

CUX1

cut-like homeobox 1

159 Gene Product Result for
Synonyms: CASP CDP CDP/Cut CDP1 COY1 CUTL1 CUX Clox Cux/CDP GOLIM6 Nbla10317 p100 p110 p200 p75
Gene ID:
Human(1523) Summary: The protein encoded by this gene is a member of the homeodomain family of DNA binding proteins. It may regulate gene expression, morphogenesis, and differentiation and it may also play a role in the cell cycle progession. Several alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Feb 2011]
Mouse(13047) cut-like homeobox 1
Rat(116639) cut-like homeobox 1
chicken(396358) cut-like homeobox 1
dog(489821) cut-like homeobox 1
domestic cat(101082615) cut-like homeobox 1
cow(523683) cut-like homeobox 1
Horse(100060510) cut-like homeobox 1
domestic guinea pig(100731562) cut-like homeobox 1
naked mole-rat(101725475) cut-like homeobox 1
sheep(101120041) cut-like homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001913 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001913 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001913 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009986 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009986 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009986 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001913 Rosetta Predictions human pricing
NM_181500 Rosetta Predictions human pricing
NM_181552 Rosetta Predictions human pricing
XM_001070410 Rosetta Predictions rat pricing
XM_001070482 Rosetta Predictions rat pricing
XM_347163 Rosetta Predictions rat pricing
NM_009986 Rosetta Predictions mouse pricing
NM_198602 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213708 predicted 630
2 SASI_Hs01_00213709 predicted 624
3 SASI_Hs01_00213710 predicted 645
4 SASI_Hs01_00213711 predicted 274
5 SASI_Hs01_00213712 predicted 331
6 SASI_Hs01_00213713 predicted 580
7 SASI_Hs01_00213714 predicted 588
8 SASI_Hs01_00213715 predicted 371
9 SASI_Hs01_00213716 predicted 517
10 SASI_Hs01_00213717 predicted 500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181500 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065230 predicted 617
2 SASI_Hs01_00065231 predicted 609
3 SASI_Hs01_00065232 predicted 635
4 SASI_Hs01_00065233 predicted 270
5 SASI_Hs01_00065234 predicted 312
6 SASI_Hs01_00065235 predicted 561
7 SASI_Hs01_00065236 predicted 575
8 SASI_Hs01_00065237 predicted 363
9 SASI_Hs01_00065238 predicted 505
10 SASI_Hs01_00065239 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181552 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047085 predicted 617
2 SASI_Hs01_00047086 predicted 601
3 SASI_Hs01_00047087 predicted 632
4 SASI_Hs01_00047088 predicted 259
5 SASI_Hs01_00047089 predicted 313
6 SASI_Hs01_00047090 predicted 564
7 SASI_Hs01_00047091 predicted 577
8 SASI_Hs01_00047092 predicted 354
9 SASI_Hs01_00047093 predicted 500
10 SASI_Hs01_00047094 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070410 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331574 predicted 1253
2 SASI_Rn02_00331575 predicted 3276
3 SASI_Rn02_00331576 predicted 1904
4 SASI_Rn02_00331577 predicted 1845
5 SASI_Rn02_00331578 predicted 451
6 SASI_Rn02_00331579 predicted 394
7 SASI_Rn02_00331580 predicted 1828
8 SASI_Rn02_00331581 predicted 896
9 SASI_Rn02_00331582 predicted 4367
10 SASI_Rn02_00331583 predicted 1471
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070482 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331798 predicted 1253
2 SASI_Rn02_00331799 predicted 3581
3 SASI_Rn02_00331800 predicted 2213
4 SASI_Rn02_00331801 predicted 2148
5 SASI_Rn02_00331802 predicted 451
6 SASI_Rn02_00331803 predicted 1665
7 SASI_Rn02_00331804 predicted 398
8 SASI_Rn02_00331805 predicted 2131
9 SASI_Rn02_00331806 predicted 898
10 SASI_Rn02_00331807 predicted 4675
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_347163 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399556 predicted 1632
2 SASI_Rn02_00399557 predicted 3660
3 SASI_Rn02_00399558 predicted 2296
4 SASI_Rn02_00399559 predicted 2231
5 SASI_Rn02_00399560 predicted 838
6 SASI_Rn02_00399561 predicted 775
7 SASI_Rn02_00399562 predicted 379
8 SASI_Rn02_00399563 predicted 2211
9 SASI_Rn02_00399564 predicted 1286
10 SASI_Rn02_00399565 predicted 4745
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009986 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317582 predicted 562
2 SASI_Mm02_00317583 predicted 313
3 SASI_Mm02_00317584 predicted 372
4 SASI_Mm02_00317585 predicted 472
5 SASI_Mm02_00317586 predicted 408
6 SASI_Mm02_00317587 predicted 286
7 SASI_Mm02_00317588 predicted 559
8 SASI_Mm02_00317589 predicted 676
9 SASI_Mm02_00317590 predicted 361
10 SASI_Mm02_00317591 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198602 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170247 predicted 538
2 SASI_Mm02_00351002 predicted 287
3 SASI_Mm02_00351003 predicted 349
4 SASI_Mm01_00170250 predicted 444
5 SASI_Mm02_00351004 predicted 377
6 SASI_Mm02_00351005 predicted 258
7 SASI_Mm02_00351006 predicted 538
8 SASI_Mm02_00351007 predicted 646
9 SASI_Mm02_00351008 predicted 331
10 SASI_Mm02_00351009 predicted 282
11 SASI_Mm01_00170246 predicted 826
12 SASI_Mm01_00170248 predicted 792
13 SASI_Mm01_00170249 predicted 405
14 SASI_Mm01_00170251 predicted 1055
15 SASI_Mm01_00170252 predicted 596
16 SASI_Mm01_00170253 predicted 398
17 SASI_Mm01_00170254 predicted 286
18 SASI_Mm01_00170255 predicted 417
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001913
VALIDATED
CUX1 MISSION shRNA Bacterial Glycerol Stock
cut-like homeobox 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001913.2-549s21c1
Sequence:CCGGAGAAGTTACAGAATGACTTTGCTCGAGCAAAGTCATTCTGTAACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001913.2-1428s21c1
Sequence:CCGGAGATCCCAGAGCCCATCAAAGCTCGAGCTTTGATGGGCTCTGGGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001913.2-637s21c1
Sequence:CCGGTAAGGTTCAGAGCCTACAAACCTCGAGGTTTGTAGGCTCTGAACCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001913.2-745s21c1
Sequence:CCGGGATCATGACGGACCTTGAAAGCTCGAGCTTTCAAGGTCCGTCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001913.2-2392s21c1
Sequence:CCGGACCGATTCCAGCTGCGGTTAACTCGAGTTAACCGCAGCTGGAATCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001913.2-1643s1c1
Sequence:CCGGGCCGACAACATCAAGCTCTTTCTCGAGAAAGAGCTTGATGTTGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001913.2-2680s1c1
Sequence:CCGGGCTTTCTTCTTTAGCAAGATACTCGAGTATCTTGCTAAAGAAGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001913.2-523s1c1
Sequence:CCGGCGAAACCATAGCTCTTGAGAACTCGAGTTCTCAAGAGCTATGGTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001913.2-1879s1c1
Sequence:CCGGCGGCTTCTTCTACACACTGTTCTCGAGAACAGTGTGTAGAAGAAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001913.2-376s1c1
Sequence:CCGGGCACGATATTGAAACAGAGAACTCGAGTTCTCTGTTTCAATATCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001913
VALIDATED
CUX1 MISSION shRNA shRNA Plasmid DNA
cut-like homeobox 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001913.2-549s21c1
Sequence:CCGGAGAAGTTACAGAATGACTTTGCTCGAGCAAAGTCATTCTGTAACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001913.2-1428s21c1
Sequence:CCGGAGATCCCAGAGCCCATCAAAGCTCGAGCTTTGATGGGCTCTGGGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001913.2-637s21c1
Sequence:CCGGTAAGGTTCAGAGCCTACAAACCTCGAGGTTTGTAGGCTCTGAACCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001913.2-745s21c1
Sequence:CCGGGATCATGACGGACCTTGAAAGCTCGAGCTTTCAAGGTCCGTCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001913.2-2392s21c1
Sequence:CCGGACCGATTCCAGCTGCGGTTAACTCGAGTTAACCGCAGCTGGAATCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001913.2-1643s1c1
Sequence:CCGGGCCGACAACATCAAGCTCTTTCTCGAGAAAGAGCTTGATGTTGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001913.2-2680s1c1
Sequence:CCGGGCTTTCTTCTTTAGCAAGATACTCGAGTATCTTGCTAAAGAAGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001913.2-523s1c1
Sequence:CCGGCGAAACCATAGCTCTTGAGAACTCGAGTTCTCAAGAGCTATGGTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001913.2-1879s1c1
Sequence:CCGGCGGCTTCTTCTACACACTGTTCTCGAGAACAGTGTGTAGAAGAAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001913.2-376s1c1
Sequence:CCGGGCACGATATTGAAACAGAGAACTCGAGTTCTCTGTTTCAATATCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001913
VALIDATED
CUX1 MISSION shRNA Lentiviral Transduction Particles
cut-like homeobox 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001913.2-549s21c1
Sequence:CCGGAGAAGTTACAGAATGACTTTGCTCGAGCAAAGTCATTCTGTAACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001913.2-1428s21c1
Sequence:CCGGAGATCCCAGAGCCCATCAAAGCTCGAGCTTTGATGGGCTCTGGGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001913.2-637s21c1
Sequence:CCGGTAAGGTTCAGAGCCTACAAACCTCGAGGTTTGTAGGCTCTGAACCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001913.2-745s21c1
Sequence:CCGGGATCATGACGGACCTTGAAAGCTCGAGCTTTCAAGGTCCGTCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001913.2-2392s21c1
Sequence:CCGGACCGATTCCAGCTGCGGTTAACTCGAGTTAACCGCAGCTGGAATCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001913.2-1643s1c1
Sequence:CCGGGCCGACAACATCAAGCTCTTTCTCGAGAAAGAGCTTGATGTTGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001913.2-2680s1c1
Sequence:CCGGGCTTTCTTCTTTAGCAAGATACTCGAGTATCTTGCTAAAGAAGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001913.2-523s1c1
Sequence:CCGGCGAAACCATAGCTCTTGAGAACTCGAGTTCTCAAGAGCTATGGTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001913.2-1879s1c1
Sequence:CCGGCGGCTTCTTCTACACACTGTTCTCGAGAACAGTGTGTAGAAGAAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001913.2-376s1c1
Sequence:CCGGGCACGATATTGAAACAGAGAACTCGAGTTCTCTGTTTCAATATCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009986
CUX1 MISSION shRNA Bacterial Glycerol Stock
cut-like homeobox 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009986.3-1221s21c1
Sequence:CCGGGCCAAGAATAGCACACTCAAACTCGAGTTTGAGTGTGCTATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009986.3-1628s21c1
Sequence:CCGGCCAGCGCATCTTCGGACATTACTCGAGTAATGTCCGAAGATGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009986.3-3335s21c1
Sequence:CCGGCAACCTCGGTCAGCGCTTATTCTCGAGAATAAGCGCTGACCGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009986.3-1848s21c1
Sequence:CCGGGAAGTACCGAAACGAAGAAATCTCGAGATTTCTTCGTTTCGGTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009986.3-4832s21c1
Sequence:CCGGAGGTTCTGGAATAACTCTTTACTCGAGTAAAGAGTTATTCCAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009986.2-1010s1c1
Sequence:CCGGGCCAAGAATAGCACACTCAAACTCGAGTTTGAGTGTGCTATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009986.2-176s1c1
Sequence:CCGGCCACTGCTAAAGAGCTTCCAACTCGAGTTGGAAGCTCTTTAGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009986.2-3341s1c1
Sequence:CCGGGCCCTCAGCATCCAAGAATTACTCGAGTAATTCTTGGATGCTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009986.2-1426s1c1
Sequence:CCGGCCTGGCTTCTACAGGAAAGTTCTCGAGAACTTTCCTGTAGAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009986.2-1699s1c1
Sequence:CCGGGCAGCTCATCAAGCACAACATCTCGAGATGTTGTGCTTGATGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009986
CUX1 MISSION shRNA shRNA Plasmid DNA
cut-like homeobox 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009986.3-1221s21c1
Sequence:CCGGGCCAAGAATAGCACACTCAAACTCGAGTTTGAGTGTGCTATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009986.3-1628s21c1
Sequence:CCGGCCAGCGCATCTTCGGACATTACTCGAGTAATGTCCGAAGATGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009986.3-3335s21c1
Sequence:CCGGCAACCTCGGTCAGCGCTTATTCTCGAGAATAAGCGCTGACCGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009986.3-1848s21c1
Sequence:CCGGGAAGTACCGAAACGAAGAAATCTCGAGATTTCTTCGTTTCGGTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009986.3-4832s21c1
Sequence:CCGGAGGTTCTGGAATAACTCTTTACTCGAGTAAAGAGTTATTCCAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009986.2-1010s1c1
Sequence:CCGGGCCAAGAATAGCACACTCAAACTCGAGTTTGAGTGTGCTATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009986.2-176s1c1
Sequence:CCGGCCACTGCTAAAGAGCTTCCAACTCGAGTTGGAAGCTCTTTAGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009986.2-3341s1c1
Sequence:CCGGGCCCTCAGCATCCAAGAATTACTCGAGTAATTCTTGGATGCTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009986.2-1426s1c1
Sequence:CCGGCCTGGCTTCTACAGGAAAGTTCTCGAGAACTTTCCTGTAGAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009986.2-1699s1c1
Sequence:CCGGGCAGCTCATCAAGCACAACATCTCGAGATGTTGTGCTTGATGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009986
CUX1 MISSION shRNA Lentiviral Transduction Particles
cut-like homeobox 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009986.3-1221s21c1
Sequence:CCGGGCCAAGAATAGCACACTCAAACTCGAGTTTGAGTGTGCTATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009986.3-1628s21c1
Sequence:CCGGCCAGCGCATCTTCGGACATTACTCGAGTAATGTCCGAAGATGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009986.3-3335s21c1
Sequence:CCGGCAACCTCGGTCAGCGCTTATTCTCGAGAATAAGCGCTGACCGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009986.3-1848s21c1
Sequence:CCGGGAAGTACCGAAACGAAGAAATCTCGAGATTTCTTCGTTTCGGTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009986.3-4832s21c1
Sequence:CCGGAGGTTCTGGAATAACTCTTTACTCGAGTAAAGAGTTATTCCAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009986.2-1010s1c1
Sequence:CCGGGCCAAGAATAGCACACTCAAACTCGAGTTTGAGTGTGCTATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009986.2-176s1c1
Sequence:CCGGCCACTGCTAAAGAGCTTCCAACTCGAGTTGGAAGCTCTTTAGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009986.2-3341s1c1
Sequence:CCGGGCCCTCAGCATCCAAGAATTACTCGAGTAATTCTTGGATGCTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009986.2-1426s1c1
Sequence:CCGGCCTGGCTTCTACAGGAAAGTTCTCGAGAACTTTCCTGTAGAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009986.2-1699s1c1
Sequence:CCGGGCAGCTCATCAAGCACAACATCTCGAGATGTTGTGCTTGATGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks