EMAIL THIS PAGE TO A FRIEND

CUX2

cut-like homeobox 2

149 Gene Product Result for
Synonyms: CDP2 CUTL2
UniProtKB ID: O14529, A7E2Y4
Gene ID:
Human(23316) Summary: This gene encodes a protein which contains three CUT domains and a homeodomain; both domains are DNA-binding motifs. A similar gene, whose gene product possesses different DNA-binding activities, is located on chromosome on chromosome 7. Two pseudogenes of this gene have been identified on chromosomes 10 and 4. [provided by RefSeq, Jan 2013]
Mouse(13048) cut-like homeobox 2
Rat(288665) cut-like homeobox 2
Zebrafish(565530) cut-like homeobox 2
chicken(416875) cut-like homeobox 2
cow(524491) cut-like homeobox 2
domestic cat(101081500) cut-like homeobox 2
dog(486267) cut-like homeobox 2
sheep(101105029) cut-like homeobox 2
naked mole-rat(101712338) cut-like homeobox 2
domestic guinea pig(100728765) cut-like homeobox 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108658 Anti-CUX2 affinity isolated antibody human, rat, mouse, rat, guinea pig, dog, rabbit, pig
western blot pricing
SAB2100508 Anti-CUX2 antibody produced in rabbit affinity isolated antibody mouse, human, rat, canine, rabbit, guinea pig
western blot pricing
HPA044772 Anti-CUX2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_027045 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_027045 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_027045 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007804 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007804 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007804 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015267 Rosetta Predictions human pricing
NM_001105931 Rosetta Predictions rat pricing
NM_007804 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015267 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193085 predicted 3702
2 SASI_Hs01_00193086 predicted 4160
3 SASI_Hs01_00193087 predicted 4155
4 SASI_Hs01_00193088 predicted 414
5 SASI_Hs01_00193090 predicted 268
6 SASI_Hs01_00193091 predicted 2452
7 SASI_Hs01_00193092 predicted 4158
8 SASI_Hs01_00193093 predicted 1972
9 SASI_Hs01_00193094 predicted 431
10 SASI_Hs02_00347420 predicted 717
11 SASI_Hs01_00193089 predicted 3514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105931 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213952 predicted 2213
2 SASI_Rn02_00213953 predicted 3203
3 SASI_Rn02_00213954 predicted 2671
4 SASI_Rn02_00213955 predicted 2955
5 SASI_Rn02_00213956 predicted 3032
6 SASI_Rn02_00213957 predicted 2414
7 SASI_Rn02_00213958 predicted 2104
8 SASI_Rn02_00213959 predicted 3227
9 SASI_Rn02_00213960 predicted 2878
10 SASI_Rn02_00213961 predicted 1830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007804 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060657 predicted 4326
2 SASI_Mm01_00060658 predicted 2971
3 SASI_Mm01_00060659 predicted 3300
4 SASI_Mm01_00060660 predicted 2590
5 SASI_Mm01_00060661 predicted 808
6 SASI_Mm01_00060662 predicted 1939
7 SASI_Mm01_00060664 predicted 4659
8 SASI_Mm01_00060665 predicted 2573
9 SASI_Mm01_00060666 predicted 3589
10 SASI_Mm02_00312508 predicted 2952
11 SASI_Mm01_00060663 predicted 2085
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_027045
CUX2 MISSION shRNA Bacterial Glycerol Stock
cut-like homeobox 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027045.11-1487s1c1
Sequence:CCGGCCTGAAGACTCACTGCTTATTCTCGAGAATAAGCAGTGAGTCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027045.11-3701s1c1
Sequence:CCGGGCCTACCTGAAACGTCGCTATCTCGAGATAGCGACGTTTCAGGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027045.11-381s1c1
Sequence:CCGGAGGAGCTTAATTCCGTCGCTTCTCGAGAAGCGACGGAATTAAGCTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027045.11-4323s1c1
Sequence:CCGGCGGGTAATGATGGACTCCCAACTCGAGTTGGGAGTCCATCATTACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027045.11-584s1c1
Sequence:CCGGCTGAGTGTTTACAAGCAATTACTCGAGTAATTGCTTGTAAACACTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_027045
CUX2 MISSION shRNA shRNA Plasmid DNA
cut-like homeobox 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027045.11-1487s1c1
Sequence:CCGGCCTGAAGACTCACTGCTTATTCTCGAGAATAAGCAGTGAGTCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027045.11-3701s1c1
Sequence:CCGGGCCTACCTGAAACGTCGCTATCTCGAGATAGCGACGTTTCAGGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027045.11-381s1c1
Sequence:CCGGAGGAGCTTAATTCCGTCGCTTCTCGAGAAGCGACGGAATTAAGCTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027045.11-4323s1c1
Sequence:CCGGCGGGTAATGATGGACTCCCAACTCGAGTTGGGAGTCCATCATTACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027045.11-584s1c1
Sequence:CCGGCTGAGTGTTTACAAGCAATTACTCGAGTAATTGCTTGTAAACACTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_027045
CUX2 MISSION shRNA Lentiviral Transduction Particles
cut-like homeobox 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027045.11-1487s1c1
Sequence:CCGGCCTGAAGACTCACTGCTTATTCTCGAGAATAAGCAGTGAGTCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027045.11-3701s1c1
Sequence:CCGGGCCTACCTGAAACGTCGCTATCTCGAGATAGCGACGTTTCAGGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027045.11-381s1c1
Sequence:CCGGAGGAGCTTAATTCCGTCGCTTCTCGAGAAGCGACGGAATTAAGCTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027045.11-4323s1c1
Sequence:CCGGCGGGTAATGATGGACTCCCAACTCGAGTTGGGAGTCCATCATTACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_027045.11-584s1c1
Sequence:CCGGCTGAGTGTTTACAAGCAATTACTCGAGTAATTGCTTGTAAACACTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007804
CUX2 MISSION shRNA Bacterial Glycerol Stock
cut-like homeobox 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007804.2-1959s1c1
Sequence:CCGGGCAACTTCTCAAGCACAACATCTCGAGATGTTGTGCTTGAGAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007804.2-4335s1c1
Sequence:CCGGCAATCCAGACTGTCCTTCATTCTCGAGAATGAAGGACAGTCTGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007804.2-1342s1c1
Sequence:CCGGGCTGACTATGAAGAGATTAAACTCGAGTTTAATCTCTTCATAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007804.2-4859s1c1
Sequence:CCGGCCGTTTACGTTTATTGTTGTACTCGAGTACAACAATAAACGTAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007804.2-1307s1c1
Sequence:CCGGCCATAGAGAAACTCCAAGAAACTCGAGTTTCTTGGAGTTTCTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007804
CUX2 MISSION shRNA shRNA Plasmid DNA
cut-like homeobox 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007804.2-1959s1c1
Sequence:CCGGGCAACTTCTCAAGCACAACATCTCGAGATGTTGTGCTTGAGAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007804.2-4335s1c1
Sequence:CCGGCAATCCAGACTGTCCTTCATTCTCGAGAATGAAGGACAGTCTGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007804.2-1342s1c1
Sequence:CCGGGCTGACTATGAAGAGATTAAACTCGAGTTTAATCTCTTCATAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007804.2-4859s1c1
Sequence:CCGGCCGTTTACGTTTATTGTTGTACTCGAGTACAACAATAAACGTAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007804.2-1307s1c1
Sequence:CCGGCCATAGAGAAACTCCAAGAAACTCGAGTTTCTTGGAGTTTCTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007804
CUX2 MISSION shRNA Lentiviral Transduction Particles
cut-like homeobox 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007804.2-1959s1c1
Sequence:CCGGGCAACTTCTCAAGCACAACATCTCGAGATGTTGTGCTTGAGAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007804.2-4335s1c1
Sequence:CCGGCAATCCAGACTGTCCTTCATTCTCGAGAATGAAGGACAGTCTGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007804.2-1342s1c1
Sequence:CCGGGCTGACTATGAAGAGATTAAACTCGAGTTTAATCTCTTCATAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007804.2-4859s1c1
Sequence:CCGGCCGTTTACGTTTATTGTTGTACTCGAGTACAACAATAAACGTAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007804.2-1307s1c1
Sequence:CCGGCCATAGAGAAACTCCAAGAAACTCGAGTTTCTTGGAGTTTCTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks