EMAIL THIS PAGE TO A FRIEND

CUZD1

CUB and zona pellucida-like domains 1

70 Gene Product Result for
Synonyms: ERG-1 UO-44
Gene ID:
Mouse(16433) CUB and zona pellucida-like domains 1
Rat(117179) CUB and zona pellucida-like domains 1
chicken(423943) CUB and zona pellucida-like domains 1
Horse(100058219) CUB and zona pellucida-like domains 1
domestic cat(101096920) CUB and zona pellucida-like domains 1
dog(486924) CUB and zona pellucida-like domains 1
domestic guinea pig(100715657) CUB and zona pellucida-like domains 1
naked mole-rat(101714790) CUB and zona pellucida-like domains 1
Domestic Rabbit(100353384) CUB and zona pellucida-like domains 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008411 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008411 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008411 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022034 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022034 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022034 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022034 Rosetta Predictions human pricing
NM_054005 Rosetta Predictions rat pricing
NM_008411 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022034 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187416 predicted 553
2 SASI_Hs02_00355381 predicted 1471
3 SASI_Hs01_00187417 predicted 463
4 SASI_Hs01_00187418 predicted 348
5 SASI_Hs01_00187419 predicted 1721
6 SASI_Hs01_00187420 predicted 1987
7 SASI_Hs01_00187421 predicted 861
8 SASI_Hs01_00187422 predicted 1046
9 SASI_Hs01_00187424 predicted 1955
10 SASI_Hs01_00187425 predicted 1549
11 SASI_Hs01_00187423 predicted 1928
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054005 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047260 predicted 392
2 SASI_Rn01_00047261 predicted 1733
3 SASI_Rn01_00047262 predicted 1004
4 SASI_Rn01_00047263 predicted 1809
5 SASI_Rn01_00047264 predicted 1066
6 SASI_Rn01_00047266 predicted 1484
7 SASI_Rn01_00047267 predicted 989
8 SASI_Rn02_00267011 predicted 620
9 SASI_Rn01_00047268 predicted 783
10 SASI_Rn01_00047269 predicted 859
11 SASI_Rn01_00047265 predicted 1596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008411 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095714 predicted 1722
2 SASI_Mm01_00095715 predicted 1437
3 SASI_Mm01_00095716 predicted 1975
4 SASI_Mm01_00095717 predicted 1056
5 SASI_Mm01_00095718 predicted 1981
6 SASI_Mm01_00095719 predicted 777
7 SASI_Mm01_00095720 predicted 1020
8 SASI_Mm02_00313859 predicted 1492
9 SASI_Mm01_00095722 predicted 1632
10 SASI_Mm01_00095723 predicted 1759
11 SASI_Mm01_00095721 predicted 937
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008411
CUZD1 MISSION shRNA Bacterial Glycerol Stock
CUB and zona pellucida-like domains 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000194018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008411.2-977s1c1
Sequence:CCGGGTCGTGCTATCTACAGATTATCTCGAGATAATCTGTAGATAGCACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008411.2-1124s1c1
Sequence:CCGGCTCAACTACAATGAGAGCAATCTCGAGATTGCTCTCATTGTAGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008411.2-1720s1c1
Sequence:CCGGCTCTGTGTATCTCAAGTGTAACTCGAGTTACACTTGAGATACACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008411.2-1172s1c1
Sequence:CCGGCCGAATGTATCAAATGTCATACTCGAGTATGACATTTGATACATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008411
CUZD1 MISSION shRNA shRNA Plasmid DNA
CUB and zona pellucida-like domains 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000194018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008411.2-977s1c1
Sequence:CCGGGTCGTGCTATCTACAGATTATCTCGAGATAATCTGTAGATAGCACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008411.2-1124s1c1
Sequence:CCGGCTCAACTACAATGAGAGCAATCTCGAGATTGCTCTCATTGTAGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008411.2-1720s1c1
Sequence:CCGGCTCTGTGTATCTCAAGTGTAACTCGAGTTACACTTGAGATACACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008411.2-1172s1c1
Sequence:CCGGCCGAATGTATCAAATGTCATACTCGAGTATGACATTTGATACATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008411
CUZD1 MISSION shRNA Lentiviral Transduction Particles
CUB and zona pellucida-like domains 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000194018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008411.2-977s1c1
Sequence:CCGGGTCGTGCTATCTACAGATTATCTCGAGATAATCTGTAGATAGCACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008411.2-1124s1c1
Sequence:CCGGCTCAACTACAATGAGAGCAATCTCGAGATTGCTCTCATTGTAGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008411.2-1720s1c1
Sequence:CCGGCTCTGTGTATCTCAAGTGTAACTCGAGTTACACTTGAGATACACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008411.2-1172s1c1
Sequence:CCGGCCGAATGTATCAAATGTCATACTCGAGTATGACATTTGATACATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022034
CUZD1 MISSION shRNA Bacterial Glycerol Stock
CUB and zona pellucida-like domains 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022034.3-1664s1c1
Sequence:CCGGCCACCTTCGAATCGTCATCAACTCGAGTTGATGACGATTCGAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022034.3-2516s1c1
Sequence:CCGGCCAGAAGCAAACGAGACATTTCTCGAGAAATGTCTCGTTTGCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022034.3-1322s1c1
Sequence:CCGGCCAGTACATTGACGTTTCAAACTCGAGTTTGAAACGTCAATGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151137    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022034.3-2348s1c1
Sequence:CCGGGTAGTCGAGATGAAACTTGTACTCGAGTACAAGTTTCATCTCGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022034.3-2519s1c1
Sequence:CCGGGAAGCAAACGAGACATTTCTTCTCGAGAAGAAATGTCTCGTTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022034.3-1949s1c1
Sequence:CCGGGAAAGGTAGAAGATCAGTCAACTCGAGTTGACTGATCTTCTACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022034.3-995s1c1
Sequence:CCGGCCCTCTTAATTCTCTCCTGTTCTCGAGAACAGGAGAGAATTAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022034.3-2599s1c1
Sequence:CCGGGCAAGTGGCAATTCAGGATTTCTCGAGAAATCCTGAATTGCCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022034.3-1270s1c1
Sequence:CCGGCTAGGGCAAGTCTGCAGTAAACTCGAGTTTACTGCAGACTTGCCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157006    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022034.3-2495s1c1
Sequence:CCGGGCTGCAATCAAGGTTGTGTCTCTCGAGAGACACAACCTTGATTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156583    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022034.3-2655s1c1
Sequence:CCGGGCCTTTCAACAGTGTGCATCTCTCGAGAGATGCACACTGTTGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022034
CUZD1 MISSION shRNA shRNA Plasmid DNA
CUB and zona pellucida-like domains 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022034.3-1664s1c1
Sequence:CCGGCCACCTTCGAATCGTCATCAACTCGAGTTGATGACGATTCGAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022034.3-2516s1c1
Sequence:CCGGCCAGAAGCAAACGAGACATTTCTCGAGAAATGTCTCGTTTGCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022034.3-1322s1c1
Sequence:CCGGCCAGTACATTGACGTTTCAAACTCGAGTTTGAAACGTCAATGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151137    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022034.3-2348s1c1
Sequence:CCGGGTAGTCGAGATGAAACTTGTACTCGAGTACAAGTTTCATCTCGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022034.3-2519s1c1
Sequence:CCGGGAAGCAAACGAGACATTTCTTCTCGAGAAGAAATGTCTCGTTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022034.3-1949s1c1
Sequence:CCGGGAAAGGTAGAAGATCAGTCAACTCGAGTTGACTGATCTTCTACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022034.3-995s1c1
Sequence:CCGGCCCTCTTAATTCTCTCCTGTTCTCGAGAACAGGAGAGAATTAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022034.3-2599s1c1
Sequence:CCGGGCAAGTGGCAATTCAGGATTTCTCGAGAAATCCTGAATTGCCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022034.3-1270s1c1
Sequence:CCGGCTAGGGCAAGTCTGCAGTAAACTCGAGTTTACTGCAGACTTGCCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157006    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022034.3-2495s1c1
Sequence:CCGGGCTGCAATCAAGGTTGTGTCTCTCGAGAGACACAACCTTGATTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156583    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022034.3-2655s1c1
Sequence:CCGGGCCTTTCAACAGTGTGCATCTCTCGAGAGATGCACACTGTTGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022034
CUZD1 MISSION shRNA Lentiviral Transduction Particles
CUB and zona pellucida-like domains 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022034.3-1664s1c1
Sequence:CCGGCCACCTTCGAATCGTCATCAACTCGAGTTGATGACGATTCGAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022034.3-2516s1c1
Sequence:CCGGCCAGAAGCAAACGAGACATTTCTCGAGAAATGTCTCGTTTGCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022034.3-1322s1c1
Sequence:CCGGCCAGTACATTGACGTTTCAAACTCGAGTTTGAAACGTCAATGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151137    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022034.3-2348s1c1
Sequence:CCGGGTAGTCGAGATGAAACTTGTACTCGAGTACAAGTTTCATCTCGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022034.3-2519s1c1
Sequence:CCGGGAAGCAAACGAGACATTTCTTCTCGAGAAGAAATGTCTCGTTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022034.3-1949s1c1
Sequence:CCGGGAAAGGTAGAAGATCAGTCAACTCGAGTTGACTGATCTTCTACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022034.3-995s1c1
Sequence:CCGGCCCTCTTAATTCTCTCCTGTTCTCGAGAACAGGAGAGAATTAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022034.3-2599s1c1
Sequence:CCGGGCAAGTGGCAATTCAGGATTTCTCGAGAAATCCTGAATTGCCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022034.3-1270s1c1
Sequence:CCGGCTAGGGCAAGTCTGCAGTAAACTCGAGTTTACTGCAGACTTGCCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157006    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022034.3-2495s1c1
Sequence:CCGGGCTGCAATCAAGGTTGTGTCTCTCGAGAGACACAACCTTGATTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156583    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022034.3-2655s1c1
Sequence:CCGGGCCTTTCAACAGTGTGCATCTCTCGAGAGATGCACACTGTTGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks