EMAIL THIS PAGE TO A FRIEND

CWC15

CWC15 spliceosome-associated protein homolog (S. cerevisiae)

70 Gene Product Result for
Synonyms: C11orf5 Cwf15 HSPC148 ORF5
UniProtKB ID: Q9P013, B2RC17, Q05BV9, Q05DM1, Q9UI29
Gene ID:
Mouse(66070) CWC15 homolog (S. cerevisiae)
Rat(300361) CWC15 spliceosome-associated protein homolog (S. cerevisiae)
chicken(418996) CWC15 spliceosome-associated protein homolog (S. cerevisiae)
cow(535258) CWC15 spliceosome-associated protein homolog (S. cerevisiae)
dog(476768) CWC15 spliceosome-associated protein homolog (S. cerevisiae)
domestic cat(101081248) CWC15 spliceosome-associated protein homolog (S. cerevisiae)
sheep(101102755) CWC15 spliceosome-associated protein homolog (S. cerevisiae)
domestic guinea pig(100736014) CWC15 spliceosome-associated protein homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023153 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023153 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023153 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016403 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016403 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016403 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130091 MISSION® esiRNA esiRNA human CWC15 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016403 Rosetta Predictions human pricing
NM_001024987 Rosetta Predictions rat pricing
NM_023153 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016403 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349413 predicted 1098
2 SASI_Hs02_00349414 predicted 1159
3 SASI_Hs02_00349415 predicted 1103
4 SASI_Hs02_00349416 predicted 1111
5 SASI_Hs02_00349417 predicted 1152
6 SASI_Hs02_00349418 predicted 1117
7 SASI_Hs02_00349419 predicted 1101
8 SASI_Hs02_00349420 predicted 1164
9 SASI_Hs02_00349421 predicted 1116
10 SASI_Hs02_00349422 predicted 1102
11 SASI_Hs01_00159373 predicted 373
12 SASI_Hs01_00159374 predicted 979
13 SASI_Hs01_00159375 predicted 138
14 SASI_Hs01_00159376 predicted 705
15 SASI_Hs01_00159377 predicted 921
16 SASI_Hs01_00159378 predicted 561
17 SASI_Hs01_00159379 predicted 930
18 SASI_Hs01_00159380 predicted 663
19 SASI_Hs01_00159381 predicted 891
20 SASI_Hs01_00159382 predicted 551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024987 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118872 predicted 491
2 SASI_Rn02_00202861 predicted 589
3 SASI_Rn02_00202862 predicted 846
4 SASI_Rn02_00202863 predicted 886
5 SASI_Rn02_00202864 predicted 580
6 SASI_Rn02_00202865 predicted 910
7 SASI_Rn02_00202866 predicted 277
8 SASI_Rn02_00202867 predicted 487
9 SASI_Rn02_00202868 predicted 231
10 SASI_Rn02_00202869 predicted 882
11 SASI_Rn01_00118866 predicted 199
12 SASI_Rn01_00118867 predicted 768
13 SASI_Rn01_00118868 predicted 443
14 SASI_Rn01_00118869 predicted 717
15 SASI_Rn01_00118870 predicted 220
16 SASI_Rn01_00118871 predicted 763
17 SASI_Rn01_00118873 predicted 826
18 SASI_Rn01_00118874 predicted 420
19 SASI_Rn01_00118875 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023153 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020386 predicted 602
2 SASI_Mm01_00020388 predicted 628
3 SASI_Mm01_00020390 predicted 602
4 SASI_Mm01_00020391 predicted 631
5 SASI_Mm02_00326875 predicted 626
6 SASI_Mm02_00326876 predicted 625
7 SASI_Mm02_00326877 predicted 631
8 SASI_Mm01_00020387 predicted 656
9 SASI_Mm01_00020389 predicted 692
10 SASI_Mm01_00020392 predicted 653
11 SASI_Mm01_00020393 predicted 598
12 SASI_Mm01_00020394 predicted 599
13 SASI_Mm01_00020395 predicted 610
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023153
VALIDATED
CWC15 MISSION shRNA Bacterial Glycerol Stock
CWC15 spliceosome-associated protein homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023153.2-900s1c1
Sequence:CCGGCCCTTAGTGTAGTACTTTATTCTCGAGAATAAAGTACTACACTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023153.2-717s1c1
Sequence:CCGGCAGAAGAAAGACAAACGATTTCTCGAGAAATCGTTTGTCTTTCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023153.2-715s1c1
Sequence:CCGGACCAGAAGAAAGACAAACGATCTCGAGATCGTTTGTCTTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023153.2-202s1c1
Sequence:CCGGGCAGAGATCTTCCCTCTCATACTCGAGTATGAGAGGGAAGATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023153.2-667s1c1
Sequence:CCGGGATGGGATGATGATGTCGTTTCTCGAGAAACGACATCATCATCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023153.3-266s21c1
Sequence:CCGGGCAGAGATCTTCCCTCTCATACTCGAGTATGAGAGGGAAGATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023153.3-779s21c1
Sequence:CCGGACCAGAAGAAAGACAAACGATCTCGAGATCGTTTGTCTTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023153.3-888s21c1
Sequence:CCGGCTAAACTGTTAAGGATCAATTCTCGAGAATTGATCCTTAACAGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023153.3-706s21c1
Sequence:CCGGCAGGCCAACTTCAAGGTTAAACTCGAGTTTAACCTTGAAGTTGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023153
VALIDATED
CWC15 MISSION shRNA shRNA Plasmid DNA
CWC15 spliceosome-associated protein homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023153.2-900s1c1
Sequence:CCGGCCCTTAGTGTAGTACTTTATTCTCGAGAATAAAGTACTACACTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023153.2-717s1c1
Sequence:CCGGCAGAAGAAAGACAAACGATTTCTCGAGAAATCGTTTGTCTTTCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023153.2-715s1c1
Sequence:CCGGACCAGAAGAAAGACAAACGATCTCGAGATCGTTTGTCTTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023153.2-202s1c1
Sequence:CCGGGCAGAGATCTTCCCTCTCATACTCGAGTATGAGAGGGAAGATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023153.2-667s1c1
Sequence:CCGGGATGGGATGATGATGTCGTTTCTCGAGAAACGACATCATCATCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023153.3-266s21c1
Sequence:CCGGGCAGAGATCTTCCCTCTCATACTCGAGTATGAGAGGGAAGATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023153.3-779s21c1
Sequence:CCGGACCAGAAGAAAGACAAACGATCTCGAGATCGTTTGTCTTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023153.3-888s21c1
Sequence:CCGGCTAAACTGTTAAGGATCAATTCTCGAGAATTGATCCTTAACAGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023153.3-706s21c1
Sequence:CCGGCAGGCCAACTTCAAGGTTAAACTCGAGTTTAACCTTGAAGTTGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023153
VALIDATED
CWC15 MISSION shRNA Lentiviral Transduction Particles
CWC15 spliceosome-associated protein homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023153.2-900s1c1
Sequence:CCGGCCCTTAGTGTAGTACTTTATTCTCGAGAATAAAGTACTACACTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023153.2-717s1c1
Sequence:CCGGCAGAAGAAAGACAAACGATTTCTCGAGAAATCGTTTGTCTTTCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023153.2-715s1c1
Sequence:CCGGACCAGAAGAAAGACAAACGATCTCGAGATCGTTTGTCTTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023153.2-202s1c1
Sequence:CCGGGCAGAGATCTTCCCTCTCATACTCGAGTATGAGAGGGAAGATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023153.2-667s1c1
Sequence:CCGGGATGGGATGATGATGTCGTTTCTCGAGAAACGACATCATCATCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023153.3-266s21c1
Sequence:CCGGGCAGAGATCTTCCCTCTCATACTCGAGTATGAGAGGGAAGATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023153.3-779s21c1
Sequence:CCGGACCAGAAGAAAGACAAACGATCTCGAGATCGTTTGTCTTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023153.3-888s21c1
Sequence:CCGGCTAAACTGTTAAGGATCAATTCTCGAGAATTGATCCTTAACAGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023153.3-706s21c1
Sequence:CCGGCAGGCCAACTTCAAGGTTAAACTCGAGTTTAACCTTGAAGTTGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016403
CWC15 MISSION shRNA Bacterial Glycerol Stock
CWC15 spliceosome-associated protein homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016403.1-789s1c1
Sequence:CCGGGTAAAGGATCATTCTGACTTTCTCGAGAAAGTCAGAATGATCCTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016403.1-305s1c1
Sequence:CCGGGAGAACATACAACCTCCTCTTCTCGAGAAGAGGAGGTTGTATGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016403.1-596s1c1
Sequence:CCGGCTCAGGCCAACTTCAAAGTTACTCGAGTAACTTTGAAGTTGGCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016403.1-168s1c1
Sequence:CCGGACCCTCTCATACAAAGATAAACTCGAGTTTATCTTTGTATGAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016403.1-598s1c1
Sequence:CCGGCAGGCCAACTTCAAAGTTAAACTCGAGTTTAACTTTGAAGTTGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016403.3-617s21c1
Sequence:CCGGGCGGAAACCCTCTCCTTAATCCTCGAGGATTAAGGAGAGGGTTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016403.3-1106s21c1
Sequence:CCGGGGAATTTATGCTGCTAGTAATCTCGAGATTACTAGCAGCATAAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016403.3-1166s21c1
Sequence:CCGGTGTATTGTGCTTGTGCATTAACTCGAGTTAATGCACAAGCACAATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016403.3-398s21c1
Sequence:CCGGAGCCACGGTTAGACCAGATTCCTCGAGGAATCTGGTCTAACCGTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016403
CWC15 MISSION shRNA shRNA Plasmid DNA
CWC15 spliceosome-associated protein homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016403.1-789s1c1
Sequence:CCGGGTAAAGGATCATTCTGACTTTCTCGAGAAAGTCAGAATGATCCTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016403.1-305s1c1
Sequence:CCGGGAGAACATACAACCTCCTCTTCTCGAGAAGAGGAGGTTGTATGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016403.1-596s1c1
Sequence:CCGGCTCAGGCCAACTTCAAAGTTACTCGAGTAACTTTGAAGTTGGCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016403.1-168s1c1
Sequence:CCGGACCCTCTCATACAAAGATAAACTCGAGTTTATCTTTGTATGAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016403.1-598s1c1
Sequence:CCGGCAGGCCAACTTCAAAGTTAAACTCGAGTTTAACTTTGAAGTTGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016403.3-617s21c1
Sequence:CCGGGCGGAAACCCTCTCCTTAATCCTCGAGGATTAAGGAGAGGGTTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016403.3-1106s21c1
Sequence:CCGGGGAATTTATGCTGCTAGTAATCTCGAGATTACTAGCAGCATAAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016403.3-1166s21c1
Sequence:CCGGTGTATTGTGCTTGTGCATTAACTCGAGTTAATGCACAAGCACAATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016403.3-398s21c1
Sequence:CCGGAGCCACGGTTAGACCAGATTCCTCGAGGAATCTGGTCTAACCGTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016403
CWC15 MISSION shRNA Lentiviral Transduction Particles
CWC15 spliceosome-associated protein homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016403.1-789s1c1
Sequence:CCGGGTAAAGGATCATTCTGACTTTCTCGAGAAAGTCAGAATGATCCTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016403.1-305s1c1
Sequence:CCGGGAGAACATACAACCTCCTCTTCTCGAGAAGAGGAGGTTGTATGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016403.1-596s1c1
Sequence:CCGGCTCAGGCCAACTTCAAAGTTACTCGAGTAACTTTGAAGTTGGCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016403.1-168s1c1
Sequence:CCGGACCCTCTCATACAAAGATAAACTCGAGTTTATCTTTGTATGAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016403.1-598s1c1
Sequence:CCGGCAGGCCAACTTCAAAGTTAAACTCGAGTTTAACTTTGAAGTTGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016403.3-617s21c1
Sequence:CCGGGCGGAAACCCTCTCCTTAATCCTCGAGGATTAAGGAGAGGGTTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016403.3-1106s21c1
Sequence:CCGGGGAATTTATGCTGCTAGTAATCTCGAGATTACTAGCAGCATAAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016403.3-1166s21c1
Sequence:CCGGTGTATTGTGCTTGTGCATTAACTCGAGTTAATGCACAAGCACAATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016403.3-398s21c1
Sequence:CCGGAGCCACGGTTAGACCAGATTCCTCGAGGAATCTGGTCTAACCGTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks