EMAIL THIS PAGE TO A FRIEND

CWC22

CWC22 spliceosome-associated protein homolog (S. cerevisiae)

73 Gene Product Result for
Synonyms: EIF4GL NCM fSAPb
Gene ID:
Mouse(80744) CWC22 spliceosome-associated protein homolog (S. cerevisiae)
Rat(362153) CWC22 spliceosome-associated protein homolog (S. cerevisiae)
domestic guinea pig(100719176) CWC22 spliceosome-associated protein homolog (S. cerevisiae)
naked mole-rat(101707573) CWC22 spliceosome-associated protein homolog (S. cerevisiae)
sheep(101121571) CWC22 spliceosome-associated protein homolog (S. cerevisiae)
Zebrafish(566033) CWC22 spliceosome-associated protein homolog (S. cerevisiae)
cow(781016) CWC22 spliceosome-associated protein homolog (S. cerevisiae)
Horse(100053942) CWC22 spliceosome-associated protein homolog (S. cerevisiae)
domestic cat(101080816) CWC22 spliceosome-associated protein homolog (S. cerevisiae)
dog(488427) CWC22 spliceosome-associated protein homolog (S. cerevisiae)
chicken(424123) CWC22 spliceosome-associated protein homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020943 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020943 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020943 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030560 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030560 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030560 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU005901 MISSION® esiRNA esiRNA targeting human CWC22 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020943 Rosetta Predictions human pricing
XM_001062863 Rosetta Predictions rat pricing
XM_342453 Rosetta Predictions rat pricing
NM_030560 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020943 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354346 predicted 2066
2 SASI_Hs01_00217929 predicted 1312
3 SASI_Hs01_00217930 predicted 2079
4 SASI_Hs01_00217931 predicted 1192
5 SASI_Hs01_00217933 predicted 1043
6 SASI_Hs01_00217934 predicted 455
7 SASI_Hs01_00217935 predicted 2366
8 SASI_Hs01_00217936 predicted 477
9 SASI_Hs01_00217937 predicted 3037
10 SASI_Hs02_00354347 predicted 2797
11 SASI_Hs01_00217932 predicted 792
12 SASI_Hs01_00217938 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062863 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00304867 predicted 2625
2 SASI_Rn02_00304868 predicted 1926
3 SASI_Rn02_00304869 predicted 856
4 SASI_Rn02_00304870 predicted 2619
5 SASI_Rn02_00304871 predicted 2114
6 SASI_Rn02_00304872 predicted 2256
7 SASI_Rn02_00304873 predicted 658
8 SASI_Rn02_00304874 predicted 767
9 SASI_Rn02_00304875 predicted 2401
10 SASI_Rn02_00304876 predicted 790
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342453 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394289 predicted 2624
2 SASI_Rn02_00394290 predicted 1925
3 SASI_Rn02_00394291 predicted 2620
4 SASI_Rn02_00394292 predicted 2107
5 SASI_Rn02_00394293 predicted 2256
6 SASI_Rn02_00394294 predicted 2409
7 SASI_Rn02_00394295 predicted 2078
8 SASI_Rn02_00394296 predicted 2476
9 SASI_Rn02_00394297 predicted 1825
10 SASI_Rn02_00394298 predicted 2007
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030560 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030070 predicted 886
2 SASI_Mm01_00030071 predicted 782
3 SASI_Mm01_00030072 predicted 866
4 SASI_Mm01_00030073 predicted 2420
5 SASI_Mm01_00030074 predicted 2650
6 SASI_Mm01_00030075 predicted 815
7 SASI_Mm01_00030076 predicted 2341
8 SASI_Mm01_00030077 predicted 813
9 SASI_Mm01_00030078 predicted 2026
10 SASI_Mm01_00030079 predicted 835
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020943
CWC22 MISSION shRNA Bacterial Glycerol Stock
CWC22 spliceosome-associated protein homolog (S. cerevisiae)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020943.2-2255s21c1
Sequence:CCGGAGGTCATTGTGGCGCAGAAACCTCGAGGTTTCTGCGCCACAATGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020943.2-2711s21c1
Sequence:CCGGGAGACCAAGAAATGCATATAGCTCGAGCTATATGCATTTCTTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020943.2-2624s21c1
Sequence:CCGGCAAATTGGAGAGATCCTATAACTCGAGTTATAGGATCTCTCCAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020943.2-2802s21c1
Sequence:CCGGGAAGCATACACACCGAATTAACTCGAGTTAATTCGGTGTGTATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020943.2-946s21c1
Sequence:CCGGGCAGCATTAGTGGCAATTATCCTCGAGGATAATTGCCACTAATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020943.2-1918s21c1
Sequence:CCGGGAAACAAACAAGTTGCGAAATCTCGAGATTTCGCAACTTGTTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020943.1-2917s1c1
Sequence:CCGGCATGCCTTATATTCAGTTGAACTCGAGTTCAACTGAATATAAGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020943.1-2339s1c1
Sequence:CCGGCCAGAAGTAAAGAGGTAGATACTCGAGTATCTACCTCTTTACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020943.1-286s1c1
Sequence:CCGGCGGGATAGAGATTACTTTGATCTCGAGATCAAAGTAATCTCTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020943.1-1886s1c1
Sequence:CCGGCCACTACATCATCCAGTAGAACTCGAGTTCTACTGGATGATGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020943.1-975s1c1
Sequence:CCGGCGAAGTATTATGCTTAGAGATCTCGAGATCTCTAAGCATAATACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020943
CWC22 MISSION shRNA shRNA Plasmid DNA
CWC22 spliceosome-associated protein homolog (S. cerevisiae)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020943.2-2255s21c1
Sequence:CCGGAGGTCATTGTGGCGCAGAAACCTCGAGGTTTCTGCGCCACAATGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020943.2-2711s21c1
Sequence:CCGGGAGACCAAGAAATGCATATAGCTCGAGCTATATGCATTTCTTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020943.2-2624s21c1
Sequence:CCGGCAAATTGGAGAGATCCTATAACTCGAGTTATAGGATCTCTCCAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020943.2-2802s21c1
Sequence:CCGGGAAGCATACACACCGAATTAACTCGAGTTAATTCGGTGTGTATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020943.2-946s21c1
Sequence:CCGGGCAGCATTAGTGGCAATTATCCTCGAGGATAATTGCCACTAATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020943.2-1918s21c1
Sequence:CCGGGAAACAAACAAGTTGCGAAATCTCGAGATTTCGCAACTTGTTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020943.1-2917s1c1
Sequence:CCGGCATGCCTTATATTCAGTTGAACTCGAGTTCAACTGAATATAAGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020943.1-2339s1c1
Sequence:CCGGCCAGAAGTAAAGAGGTAGATACTCGAGTATCTACCTCTTTACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020943.1-286s1c1
Sequence:CCGGCGGGATAGAGATTACTTTGATCTCGAGATCAAAGTAATCTCTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020943.1-1886s1c1
Sequence:CCGGCCACTACATCATCCAGTAGAACTCGAGTTCTACTGGATGATGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020943.1-975s1c1
Sequence:CCGGCGAAGTATTATGCTTAGAGATCTCGAGATCTCTAAGCATAATACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020943
CWC22 MISSION shRNA Lentiviral Transduction Particles
CWC22 spliceosome-associated protein homolog (S. cerevisiae)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020943.2-2255s21c1
Sequence:CCGGAGGTCATTGTGGCGCAGAAACCTCGAGGTTTCTGCGCCACAATGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020943.2-2711s21c1
Sequence:CCGGGAGACCAAGAAATGCATATAGCTCGAGCTATATGCATTTCTTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020943.2-2624s21c1
Sequence:CCGGCAAATTGGAGAGATCCTATAACTCGAGTTATAGGATCTCTCCAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020943.2-2802s21c1
Sequence:CCGGGAAGCATACACACCGAATTAACTCGAGTTAATTCGGTGTGTATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020943.2-946s21c1
Sequence:CCGGGCAGCATTAGTGGCAATTATCCTCGAGGATAATTGCCACTAATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020943.2-1918s21c1
Sequence:CCGGGAAACAAACAAGTTGCGAAATCTCGAGATTTCGCAACTTGTTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020943.1-2917s1c1
Sequence:CCGGCATGCCTTATATTCAGTTGAACTCGAGTTCAACTGAATATAAGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020943.1-2339s1c1
Sequence:CCGGCCAGAAGTAAAGAGGTAGATACTCGAGTATCTACCTCTTTACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020943.1-286s1c1
Sequence:CCGGCGGGATAGAGATTACTTTGATCTCGAGATCAAAGTAATCTCTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020943.1-1886s1c1
Sequence:CCGGCCACTACATCATCCAGTAGAACTCGAGTTCTACTGGATGATGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020943.1-975s1c1
Sequence:CCGGCGAAGTATTATGCTTAGAGATCTCGAGATCTCTAAGCATAATACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030560
VALIDATED
CWC22 MISSION shRNA Bacterial Glycerol Stock
CWC22 spliceosome-associated protein homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030560.3-2342s21c1
Sequence:CCGGCGGCTCATTCAGCTAAAGGTACTCGAGTACCTTTAGCTGAATGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030560.3-1243s21c1
Sequence:CCGGCCTGTTATTCTGGAAGGACTTCTCGAGAAGTCCTTCCAGAATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030560.3-2330s21c1
Sequence:CCGGCCTCAGGTATCACGGCTCATTCTCGAGAATGAGCCGTGATACCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287405    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030560.3-3002s21c1
Sequence:CCGGCTCTTGTATAAAGTACCTGTTCTCGAGAACAGGTACTTTATACAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030560.3-1919s21c1
Sequence:CCGGCGACATCGTCTAGTCGAATTTCTCGAGAAATTCGACTAGACGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030560.2-3003s1c1
Sequence:CCGGCTCTTGTATAAAGTACCTGTTCTCGAGAACAGGTACTTTATACAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030560.2-2343s1c1
Sequence:CCGGCGGCTCATTCAGCTAAAGGTACTCGAGTACCTTTAGCTGAATGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030560.2-2331s1c1
Sequence:CCGGCCTCAGGTATCACGGCTCATTCTCGAGAATGAGCCGTGATACCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030560.2-1244s1c1
Sequence:CCGGCCTGTTATTCTGGAAGGACTTCTCGAGAAGTCCTTCCAGAATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030560.2-674s1c1
Sequence:CCGGGCTCTGAAGAAATCCATCAATCTCGAGATTGATGGATTTCTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030560
VALIDATED
CWC22 MISSION shRNA shRNA Plasmid DNA
CWC22 spliceosome-associated protein homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030560.3-2342s21c1
Sequence:CCGGCGGCTCATTCAGCTAAAGGTACTCGAGTACCTTTAGCTGAATGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030560.3-1243s21c1
Sequence:CCGGCCTGTTATTCTGGAAGGACTTCTCGAGAAGTCCTTCCAGAATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030560.3-2330s21c1
Sequence:CCGGCCTCAGGTATCACGGCTCATTCTCGAGAATGAGCCGTGATACCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287405    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030560.3-3002s21c1
Sequence:CCGGCTCTTGTATAAAGTACCTGTTCTCGAGAACAGGTACTTTATACAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030560.3-1919s21c1
Sequence:CCGGCGACATCGTCTAGTCGAATTTCTCGAGAAATTCGACTAGACGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030560.2-3003s1c1
Sequence:CCGGCTCTTGTATAAAGTACCTGTTCTCGAGAACAGGTACTTTATACAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030560.2-2343s1c1
Sequence:CCGGCGGCTCATTCAGCTAAAGGTACTCGAGTACCTTTAGCTGAATGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030560.2-2331s1c1
Sequence:CCGGCCTCAGGTATCACGGCTCATTCTCGAGAATGAGCCGTGATACCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030560.2-1244s1c1
Sequence:CCGGCCTGTTATTCTGGAAGGACTTCTCGAGAAGTCCTTCCAGAATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030560.2-674s1c1
Sequence:CCGGGCTCTGAAGAAATCCATCAATCTCGAGATTGATGGATTTCTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030560
VALIDATED
CWC22 MISSION shRNA Lentiviral Transduction Particles
CWC22 spliceosome-associated protein homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030560.3-2342s21c1
Sequence:CCGGCGGCTCATTCAGCTAAAGGTACTCGAGTACCTTTAGCTGAATGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030560.3-1243s21c1
Sequence:CCGGCCTGTTATTCTGGAAGGACTTCTCGAGAAGTCCTTCCAGAATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030560.3-2330s21c1
Sequence:CCGGCCTCAGGTATCACGGCTCATTCTCGAGAATGAGCCGTGATACCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287405    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030560.3-3002s21c1
Sequence:CCGGCTCTTGTATAAAGTACCTGTTCTCGAGAACAGGTACTTTATACAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030560.3-1919s21c1
Sequence:CCGGCGACATCGTCTAGTCGAATTTCTCGAGAAATTCGACTAGACGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030560.2-3003s1c1
Sequence:CCGGCTCTTGTATAAAGTACCTGTTCTCGAGAACAGGTACTTTATACAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030560.2-2343s1c1
Sequence:CCGGCGGCTCATTCAGCTAAAGGTACTCGAGTACCTTTAGCTGAATGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030560.2-2331s1c1
Sequence:CCGGCCTCAGGTATCACGGCTCATTCTCGAGAATGAGCCGTGATACCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030560.2-1244s1c1
Sequence:CCGGCCTGTTATTCTGGAAGGACTTCTCGAGAAGTCCTTCCAGAATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030560.2-674s1c1
Sequence:CCGGGCTCTGAAGAAATCCATCAATCTCGAGATTGATGGATTTCTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks