EMAIL THIS PAGE TO A FRIEND

CWC25

CWC25 spliceosome-associated protein homolog (S. cerevisiae)

50 Gene Product Result for
Synonyms: CCDC49
UniProtKB ID: Q9NXE8, A0JLM3, Q68DK5
Gene ID:
Human(54883) Summary: This gene encodes a factor that is part of the multi-protein C complex involved in pre-mRNA splicing. Alternatively spliced transcripts have been described for this gene. [provided by RefSeq, Nov 2012]
Mouse(67480) CWC25 spliceosome-associated protein homolog (S. cerevisiae)
Rat(360613) CWC25 spliceosome-associated protein homolog (S. cerevisiae)
Zebrafish(406771) CWC25 spliceosome-associated protein homolog (S. cerevisiae)
cow(512527) CWC25 spliceosome-associated protein homolog (S. cerevisiae)
domestic cat(101087537) CWC25 spliceosome-associated protein homolog (S. cerevisiae)
dog(480536) CWC25 spliceosome-associated protein homolog (S. cerevisiae)
chicken(420000) CWC25 spliceosome-associated protein homolog (S. cerevisiae)
fruit fly(33460) CG2843 gene product from transcript CG2843-RA
sheep(101121107) CWC25 spliceosome-associated protein homolog (S. cerevisiae)
naked mole-rat(101719313) CWC25 spliceosome-associated protein homolog (S. cerevisiae)
domestic guinea pig(100725997) CWC25 spliceosome-associated protein homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017748 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017748 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017748 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026186 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026186 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026186 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017748 Rosetta Predictions human pricing
NM_001108295 Rosetta Predictions rat pricing
NM_026186 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017748 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350557 predicted 1554
2 SASI_Hs01_00076209 predicted 1045
3 SASI_Hs01_00076210 predicted 1490
4 SASI_Hs01_00076211 predicted 1048
5 SASI_Hs01_00076212 predicted 1572
6 SASI_Hs01_00076213 predicted 1295
7 SASI_Hs01_00076215 predicted 1525
8 SASI_Hs01_00076216 predicted 1602
9 SASI_Hs01_00076217 predicted 958
10 SASI_Hs01_00076218 predicted 1483
11 SASI_Hs01_00076214 predicted 1528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108295 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237249 predicted 1852
2 SASI_Rn02_00237250 predicted 1336
3 SASI_Rn02_00237251 predicted 1712
4 SASI_Rn02_00237252 predicted 1365
5 SASI_Rn02_00237253 predicted 1802
6 SASI_Rn02_00237254 predicted 1413
7 SASI_Rn02_00237255 predicted 1228
8 SASI_Rn02_00237256 predicted 1055
9 SASI_Rn02_00237257 predicted 1498
10 SASI_Rn02_00237258 predicted 1322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026186 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329834 predicted 1003
2 SASI_Mm02_00329835 predicted 1844
3 SASI_Mm02_00329836 predicted 1235
4 SASI_Mm02_00329837 predicted 1469
5 SASI_Mm02_00329838 predicted 1066
6 SASI_Mm02_00329839 predicted 1855
7 SASI_Mm02_00329840 predicted 1678
8 SASI_Mm02_00329841 predicted 1335
9 SASI_Mm02_00329842 predicted 1520
10 SASI_Mm02_00329843 predicted 1500
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017748
VALIDATED
CWC25 MISSION shRNA Bacterial Glycerol Stock
CWC25 spliceosome-associated protein homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017748.3-207s1c1
Sequence:CCGGGAATGTGGAGAAAGTGTGGAACTCGAGTTCCACACTTTCTCCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_017748.3-1305s1c1
Sequence:CCGGGAAGTTCATCCACCGCATGAACTCGAGTTCATGCGGTGGATGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017748.3-779s1c1
Sequence:CCGGGATCACAGAAGAAGATGGCAACTCGAGTTGCCATCTTCTTCTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017748.3-1236s1c1
Sequence:CCGGCATCCTCAAGAGGCATGCTAACTCGAGTTAGCATGCCTCTTGAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140964    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017748.3-1556s1c1
Sequence:CCGGCCTGCTTCATTGAGTCCTGAACTCGAGTTCAGGACTCAATGAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_017748.3-253s1c1
Sequence:CCGGCGGAAGAAGATTGAGGAGCTTCTCGAGAAGCTCCTCAATCTTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142481    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_017748.3-1580s1c1
Sequence:CCGGGCTCACTTCCTTTGAGAGCTACTCGAGTAGCTCTCAAAGGAAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017748.3-1365s1c1
Sequence:CCGGGAAGCGGAATATCTACTCTTTCTCGAGAAAGAGTAGATATTCCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017748.3-733s21c1
Sequence:CCGGTCGAGTAGTGATCGTTCCAGCCTCGAGGCTGGAACGATCACTACTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017748.3-917s21c1
Sequence:CCGGAGAACCATTCCAGATCCAGAACTCGAGTTCTGGATCTGGAATGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017748.3-1247s21c1
Sequence:CCGGGGCATGCTAAGGATGAGGAACCTCGAGGTTCCTCATCCTTAGCATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017748.3-390s21c1
Sequence:CCGGGATGGTGAACCGTGACGAGTACTCGAGTACTCGTCACGGTTCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017748
VALIDATED
CWC25 MISSION shRNA shRNA Plasmid DNA
CWC25 spliceosome-associated protein homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017748.3-207s1c1
Sequence:CCGGGAATGTGGAGAAAGTGTGGAACTCGAGTTCCACACTTTCTCCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_017748.3-1305s1c1
Sequence:CCGGGAAGTTCATCCACCGCATGAACTCGAGTTCATGCGGTGGATGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017748.3-779s1c1
Sequence:CCGGGATCACAGAAGAAGATGGCAACTCGAGTTGCCATCTTCTTCTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017748.3-1236s1c1
Sequence:CCGGCATCCTCAAGAGGCATGCTAACTCGAGTTAGCATGCCTCTTGAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140964    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017748.3-1556s1c1
Sequence:CCGGCCTGCTTCATTGAGTCCTGAACTCGAGTTCAGGACTCAATGAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_017748.3-253s1c1
Sequence:CCGGCGGAAGAAGATTGAGGAGCTTCTCGAGAAGCTCCTCAATCTTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142481    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_017748.3-1580s1c1
Sequence:CCGGGCTCACTTCCTTTGAGAGCTACTCGAGTAGCTCTCAAAGGAAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017748.3-1365s1c1
Sequence:CCGGGAAGCGGAATATCTACTCTTTCTCGAGAAAGAGTAGATATTCCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017748.3-733s21c1
Sequence:CCGGTCGAGTAGTGATCGTTCCAGCCTCGAGGCTGGAACGATCACTACTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017748.3-917s21c1
Sequence:CCGGAGAACCATTCCAGATCCAGAACTCGAGTTCTGGATCTGGAATGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017748.3-1247s21c1
Sequence:CCGGGGCATGCTAAGGATGAGGAACCTCGAGGTTCCTCATCCTTAGCATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017748.3-390s21c1
Sequence:CCGGGATGGTGAACCGTGACGAGTACTCGAGTACTCGTCACGGTTCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017748
VALIDATED
CWC25 MISSION shRNA Lentiviral Transduction Particles
CWC25 spliceosome-associated protein homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017748.3-207s1c1
Sequence:CCGGGAATGTGGAGAAAGTGTGGAACTCGAGTTCCACACTTTCTCCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_017748.3-1305s1c1
Sequence:CCGGGAAGTTCATCCACCGCATGAACTCGAGTTCATGCGGTGGATGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017748.3-779s1c1
Sequence:CCGGGATCACAGAAGAAGATGGCAACTCGAGTTGCCATCTTCTTCTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017748.3-1236s1c1
Sequence:CCGGCATCCTCAAGAGGCATGCTAACTCGAGTTAGCATGCCTCTTGAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140964    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017748.3-1556s1c1
Sequence:CCGGCCTGCTTCATTGAGTCCTGAACTCGAGTTCAGGACTCAATGAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_017748.3-253s1c1
Sequence:CCGGCGGAAGAAGATTGAGGAGCTTCTCGAGAAGCTCCTCAATCTTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142481    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_017748.3-1580s1c1
Sequence:CCGGGCTCACTTCCTTTGAGAGCTACTCGAGTAGCTCTCAAAGGAAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017748.3-1365s1c1
Sequence:CCGGGAAGCGGAATATCTACTCTTTCTCGAGAAAGAGTAGATATTCCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017748.3-733s21c1
Sequence:CCGGTCGAGTAGTGATCGTTCCAGCCTCGAGGCTGGAACGATCACTACTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017748.3-917s21c1
Sequence:CCGGAGAACCATTCCAGATCCAGAACTCGAGTTCTGGATCTGGAATGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017748.3-1247s21c1
Sequence:CCGGGGCATGCTAAGGATGAGGAACCTCGAGGTTCCTCATCCTTAGCATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017748.3-390s21c1
Sequence:CCGGGATGGTGAACCGTGACGAGTACTCGAGTACTCGTCACGGTTCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026186
VALIDATED
CWC25 MISSION shRNA Bacterial Glycerol Stock
CWC25 spliceosome-associated protein homolog (S. cerevisiae)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026186.2-530s1c1
Sequence:CCGGCTCTTCATCATAAGGAAGAAACTCGAGTTTCTTCCTTATGATGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026186.2-613s1c1
Sequence:CCGGGTTGCAAATGAGCCTTGAGAACTCGAGTTCTCAAGGCTCATTTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026186.2-521s1c1
Sequence:CCGGGAAGACCCTCTCTTCATCATACTCGAGTATGATGAAGAGAGGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026186.2-854s1c1
Sequence:CCGGCAGAGGGCGATAAAGAACAATCTCGAGATTGTTCTTTATCGCCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026186
VALIDATED
CWC25 MISSION shRNA shRNA Plasmid DNA
CWC25 spliceosome-associated protein homolog (S. cerevisiae)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026186.2-530s1c1
Sequence:CCGGCTCTTCATCATAAGGAAGAAACTCGAGTTTCTTCCTTATGATGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026186.2-613s1c1
Sequence:CCGGGTTGCAAATGAGCCTTGAGAACTCGAGTTCTCAAGGCTCATTTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026186.2-521s1c1
Sequence:CCGGGAAGACCCTCTCTTCATCATACTCGAGTATGATGAAGAGAGGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026186.2-854s1c1
Sequence:CCGGCAGAGGGCGATAAAGAACAATCTCGAGATTGTTCTTTATCGCCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026186
VALIDATED
CWC25 MISSION shRNA Lentiviral Transduction Particles
CWC25 spliceosome-associated protein homolog (S. cerevisiae)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026186.2-530s1c1
Sequence:CCGGCTCTTCATCATAAGGAAGAAACTCGAGTTTCTTCCTTATGATGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026186.2-613s1c1
Sequence:CCGGGTTGCAAATGAGCCTTGAGAACTCGAGTTCTCAAGGCTCATTTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026186.2-521s1c1
Sequence:CCGGGAAGACCCTCTCTTCATCATACTCGAGTATGATGAAGAGAGGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026186.2-854s1c1
Sequence:CCGGCAGAGGGCGATAAAGAACAATCTCGAGATTGTTCTTTATCGCCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks