EMAIL THIS PAGE TO A FRIEND

CWC27

CWC27 spliceosome-associated protein homolog (S. cerevisiae)

82 Gene Product Result for
Synonyms: NY-CO-10 SDCCAG10
UniProtKB ID: Q6UX04, O60529, O60530, Q96EM3
Gene ID:
Mouse(67285) CWC27 spliceosome-associated protein homolog (S. cerevisiae)
Rat(361887) CWC27 spliceosome-associated protein homolog (S. cerevisiae)
domestic guinea pig(100728843) CWC27 spliceosome-associated protein homolog (S. cerevisiae)
naked mole-rat(101716917) CWC27 spliceosome-associated protein homolog (S. cerevisiae)
sheep(101104091) CWC27 spliceosome-associated protein homolog (S. cerevisiae)
Domestic Rabbit(100355298) CWC27 spliceosome-associated protein homolog (S. cerevisiae)
Zebrafish(394078) CWC27 spliceosome-associated protein homolog (S. cerevisiae)
chicken(427159) CWC27 spliceosome-associated protein homolog (S. cerevisiae)
domestic cat(101080609) CWC27 spliceosome-associated protein homolog (S. cerevisiae)
cow(504397) CWC27 spliceosome-associated protein homolog (S. cerevisiae)
dog(478076) CWC27 spliceosome-associated protein homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005869 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005869 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005869 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026072 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026072 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026072 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005869 Rosetta Predictions human pricing
NM_001013199 Rosetta Predictions rat pricing
NM_026072 Rosetta Predictions mouse pricing
XM_127535 Rosetta Predictions mouse pricing
XM_887416 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005869 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236846 predicted 285
2 SASI_Hs01_00236847 predicted 278
3 SASI_Hs01_00236848 predicted 341
4 SASI_Hs01_00236850 predicted 659
5 SASI_Hs01_00236851 predicted 514
6 SASI_Hs01_00236852 predicted 341
7 SASI_Hs02_00340437 predicted 735
8 SASI_Hs01_00236853 predicted 444
9 SASI_Hs01_00236855 predicted 336
10 SASI_Hs02_00340438 predicted 452
11 SASI_Hs01_00236849 predicted 577
12 SASI_Hs01_00236854 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013199 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083135 predicted 1321
2 SASI_Rn01_00083136 predicted 578
3 SASI_Rn01_00083138 predicted 934
4 SASI_Rn01_00083139 predicted 1216
5 SASI_Rn01_00083140 predicted 1019
6 SASI_Rn01_00083141 predicted 414
7 SASI_Rn01_00083142 predicted 595
8 SASI_Rn01_00083143 predicted 572
9 SASI_Rn01_00083144 predicted 360
10 SASI_Rn02_00200972 predicted 308
11 SASI_Rn01_00083137 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026072 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329627 predicted 361
2 SASI_Mm02_00329628 predicted 281
3 SASI_Mm02_00329629 predicted 683
4 SASI_Mm02_00329630 predicted 622
5 SASI_Mm02_00329631 predicted 1411
6 SASI_Mm02_00329632 predicted 1172
7 SASI_Mm02_00329633 predicted 1370
8 SASI_Mm02_00329634 predicted 1089
9 SASI_Mm02_00329635 predicted 790
10 SASI_Mm02_00329636 predicted 619
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_127535 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00231080 predicted 369
2 SASI_Mm01_00231081 predicted 288
3 SASI_Mm01_00231082 predicted 689
4 SASI_Mm01_00231083 predicted 630
5 SASI_Mm01_00231084 predicted 1423
6 SASI_Mm01_00231085 predicted 1186
7 SASI_Mm01_00231086 predicted 1383
8 SASI_Mm01_00231087 predicted 1103
9 SASI_Mm01_00231088 predicted 1382
10 SASI_Mm01_00231089 predicted 524
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_887416 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247673 predicted 247
2 SASI_Mm01_00247674 predicted 574
3 SASI_Mm01_00247675 predicted 501
4 SASI_Mm01_00247676 predicted 1295
5 SASI_Mm01_00247677 predicted 1056
6 SASI_Mm01_00247678 predicted 1259
7 SASI_Mm01_00247679 predicted 970
8 SASI_Mm01_00247680 predicted 672
9 SASI_Mm01_00247681 predicted 509
10 SASI_Mm01_00247682 predicted 1251
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005869
VALIDATED
CWC27 MISSION shRNA Bacterial Glycerol Stock
CWC27 spliceosome-associated protein homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350972    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005869.2-1665s21c1
Sequence:CCGGGCTGGAAATGTGCCTACAATGCTCGAGCATTGTAGGCACATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005869.2-574s21c1
Sequence:CCGGCGAGCAGATGAACTTAACAATCTCGAGATTGTTAAGTTCATCTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005869.2-1191s21c1
Sequence:CCGGACGGGAACTCTTAGCAGCAAACTCGAGTTTGCTGCTAAGAGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005869.2-1053s21c1
Sequence:CCGGGAACCTGATGAGAGAAAGAATCTCGAGATTCTTTCTCTCATCAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005869.x-1609s1c1
Sequence:CCGGTAATGATAACCAGAACTTGCTCTCGAGAGCAAGTTCTGGTTATCATTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005869.x-536s1c1
Sequence:CCGGCGAGCAGATGAACTTAACAATCTCGAGATTGTTAAGTTCATCTGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005869.x-1153s1c1
Sequence:CCGGACGGGAACTCTTAGCAGCAAACTCGAGTTTGCTGCTAAGAGTTCCCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005869.x-1015s1c1
Sequence:CCGGGAACCTGATGAGAGAAAGAATCTCGAGATTCTTTCTCTCATCAGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005869.x-641s1c1
Sequence:CCGGAGACCACATAATCCACACAAACTCGAGTTTGTGTGGATTATGTGGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005869
VALIDATED
CWC27 MISSION shRNA shRNA Plasmid DNA
CWC27 spliceosome-associated protein homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350972    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005869.2-1665s21c1
Sequence:CCGGGCTGGAAATGTGCCTACAATGCTCGAGCATTGTAGGCACATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005869.2-574s21c1
Sequence:CCGGCGAGCAGATGAACTTAACAATCTCGAGATTGTTAAGTTCATCTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005869.2-1191s21c1
Sequence:CCGGACGGGAACTCTTAGCAGCAAACTCGAGTTTGCTGCTAAGAGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005869.2-1053s21c1
Sequence:CCGGGAACCTGATGAGAGAAAGAATCTCGAGATTCTTTCTCTCATCAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005869.x-1609s1c1
Sequence:CCGGTAATGATAACCAGAACTTGCTCTCGAGAGCAAGTTCTGGTTATCATTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005869.x-536s1c1
Sequence:CCGGCGAGCAGATGAACTTAACAATCTCGAGATTGTTAAGTTCATCTGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005869.x-1153s1c1
Sequence:CCGGACGGGAACTCTTAGCAGCAAACTCGAGTTTGCTGCTAAGAGTTCCCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005869.x-1015s1c1
Sequence:CCGGGAACCTGATGAGAGAAAGAATCTCGAGATTCTTTCTCTCATCAGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005869.x-641s1c1
Sequence:CCGGAGACCACATAATCCACACAAACTCGAGTTTGTGTGGATTATGTGGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005869
VALIDATED
CWC27 MISSION shRNA Lentiviral Transduction Particles
CWC27 spliceosome-associated protein homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350972    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005869.2-1665s21c1
Sequence:CCGGGCTGGAAATGTGCCTACAATGCTCGAGCATTGTAGGCACATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005869.2-574s21c1
Sequence:CCGGCGAGCAGATGAACTTAACAATCTCGAGATTGTTAAGTTCATCTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005869.2-1191s21c1
Sequence:CCGGACGGGAACTCTTAGCAGCAAACTCGAGTTTGCTGCTAAGAGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005869.2-1053s21c1
Sequence:CCGGGAACCTGATGAGAGAAAGAATCTCGAGATTCTTTCTCTCATCAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005869.x-1609s1c1
Sequence:CCGGTAATGATAACCAGAACTTGCTCTCGAGAGCAAGTTCTGGTTATCATTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005869.x-536s1c1
Sequence:CCGGCGAGCAGATGAACTTAACAATCTCGAGATTGTTAAGTTCATCTGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005869.x-1153s1c1
Sequence:CCGGACGGGAACTCTTAGCAGCAAACTCGAGTTTGCTGCTAAGAGTTCCCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005869.x-1015s1c1
Sequence:CCGGGAACCTGATGAGAGAAAGAATCTCGAGATTCTTTCTCTCATCAGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005869.x-641s1c1
Sequence:CCGGAGACCACATAATCCACACAAACTCGAGTTTGTGTGGATTATGTGGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026072
VALIDATED
CWC27 MISSION shRNA Bacterial Glycerol Stock
CWC27 spliceosome-associated protein homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026072.1-1375s21c1
Sequence:CCGGGCACTACTGAGCCAGTTTAAACTCGAGTTTAAACTGGCTCAGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251244    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026072.1-1679s21c1
Sequence:CCGGCCTGTCACAGCCATGTCTATGCTCGAGCATAGACATGGCTGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026072.1-1024s21c1
Sequence:CCGGAGTGCAGAGCGTGACGAATACCTCGAGGTATTCGTCACGCTCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026072.1-651s21c1
Sequence:CCGGACGCCTGACAGAAGTAGATATCTCGAGATATCTACTTCTGTCAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026072.1-576s21c1
Sequence:CCGGGGGCCGAGCAGATGAACTTAACTCGAGTTAAGTTCATCTGCTCGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026072
VALIDATED
CWC27 MISSION shRNA shRNA Plasmid DNA
CWC27 spliceosome-associated protein homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026072.1-1375s21c1
Sequence:CCGGGCACTACTGAGCCAGTTTAAACTCGAGTTTAAACTGGCTCAGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251244    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026072.1-1679s21c1
Sequence:CCGGCCTGTCACAGCCATGTCTATGCTCGAGCATAGACATGGCTGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026072.1-1024s21c1
Sequence:CCGGAGTGCAGAGCGTGACGAATACCTCGAGGTATTCGTCACGCTCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026072.1-651s21c1
Sequence:CCGGACGCCTGACAGAAGTAGATATCTCGAGATATCTACTTCTGTCAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026072.1-576s21c1
Sequence:CCGGGGGCCGAGCAGATGAACTTAACTCGAGTTAAGTTCATCTGCTCGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026072
VALIDATED
CWC27 MISSION shRNA Lentiviral Transduction Particles
CWC27 spliceosome-associated protein homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026072.1-1375s21c1
Sequence:CCGGGCACTACTGAGCCAGTTTAAACTCGAGTTTAAACTGGCTCAGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251244    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026072.1-1679s21c1
Sequence:CCGGCCTGTCACAGCCATGTCTATGCTCGAGCATAGACATGGCTGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026072.1-1024s21c1
Sequence:CCGGAGTGCAGAGCGTGACGAATACCTCGAGGTATTCGTCACGCTCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026072.1-651s21c1
Sequence:CCGGACGCCTGACAGAAGTAGATATCTCGAGATATCTACTTCTGTCAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026072.1-576s21c1
Sequence:CCGGGGGCCGAGCAGATGAACTTAACTCGAGTTAAGTTCATCTGCTCGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks