EMAIL THIS PAGE TO A FRIEND

CWF19L1

CWF19-like 1, cell cycle control (S. pombe)

Gene ID:
Mouse(72502) CWF19-like 1, cell cycle control (S. pombe)
Rat(365465) CWF19-like 1, cell cycle control (S. pombe)
Zebrafish(387304) CWF19-like 1, cell cycle control
cow(506212) CWF19-like 1, cell cycle control (S. pombe)
Horse(100060550) CWF19-like 1, cell cycle control (S. pombe)
domestic cat(101090898) CWF19-like 1, cell cycle control (S. pombe)
dog(477797) CWF19-like 1, cell cycle control (S. pombe)
chicken(770765) CWF19-like 1, cell cycle control (S. pombe)
chicken(101667773) CWF19-like 1, cell cycle control (S. pombe)
chicken(101749626) CWF19-like 1, cell cycle control (S. pombe)
sheep(101121304) CWF19-like 1, cell cycle control (S. pombe)
naked mole-rat(101720230) CWF19-like 1, cell cycle control (S. pombe)
domestic guinea pig(100726806) CWF19-like 1, cell cycle control (S. pombe)
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018294 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018294 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018294 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081077 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081077 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081077 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018294 Rosetta Predictions human pricing
NM_001108928 Rosetta Predictions rat pricing
NM_001081077 Rosetta Predictions mouse pricing
XM_129328 Rosetta Predictions mouse pricing
XM_901651 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018294 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127035 predicted 282
2 SASI_Hs01_00127036 predicted 1205
3 SASI_Hs01_00127038 predicted 1284
4 SASI_Hs01_00127039 predicted 640
5 SASI_Hs02_00351692 predicted 1298
6 SASI_Hs01_00127040 predicted 1374
7 SASI_Hs01_00127041 predicted 1407
8 SASI_Hs01_00127042 predicted 1367
9 SASI_Hs01_00127043 predicted 502
10 SASI_Hs01_00127044 predicted 260
11 SASI_Hs01_00127037 predicted 807
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108928 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243464 predicted 645
2 SASI_Rn02_00243465 predicted 1251
3 SASI_Rn02_00243466 predicted 945
4 SASI_Rn02_00243467 predicted 865
5 SASI_Rn02_00243468 predicted 1604
6 SASI_Rn02_00243469 predicted 302
7 SASI_Rn02_00243470 predicted 947
8 SASI_Rn02_00243471 predicted 1360
9 SASI_Rn02_00243472 predicted 1244
10 SASI_Rn02_00243473 predicted 263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081077 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294951 predicted 765
2 SASI_Mm02_00294952 predicted 1738
3 SASI_Mm02_00294953 predicted 1303
4 SASI_Mm02_00294954 predicted 278
5 SASI_Mm02_00294955 predicted 818
6 SASI_Mm02_00294956 predicted 1574
7 SASI_Mm02_00294957 predicted 750
8 SASI_Mm02_00294958 predicted 358
9 SASI_Mm02_00294959 predicted 1102
10 SASI_Mm02_00294960 predicted 272
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_129328 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00206818 predicted 1284
2 SASI_Mm01_00206819 predicted 1257
3 SASI_Mm01_00206820 predicted 708
4 SASI_Mm01_00206821 predicted 876
5 SASI_Mm01_00206822 predicted 1256
6 SASI_Mm01_00206823 predicted 940
7 SASI_Mm01_00206824 predicted 1440
8 SASI_Mm01_00206825 predicted 863
9 SASI_Mm01_00206826 predicted 1237
10 SASI_Mm01_00206827 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901651 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205672 predicted 2537
2 SASI_Mm01_00205673 predicted 2504
3 SASI_Mm01_00205674 predicted 1953
4 SASI_Mm01_00205675 predicted 2115
5 SASI_Mm01_00205676 predicted 2507
6 SASI_Mm01_00205677 predicted 2183
7 SASI_Mm01_00205678 predicted 2685
8 SASI_Mm01_00205679 predicted 2114
9 SASI_Mm01_00205680 predicted 2486
10 SASI_Mm01_00205681 predicted 2072
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018294
CWF19L1 MISSION shRNA Bacterial Glycerol Stock
CWF19-like 1, cell cycle control (S. pombe)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018294.3-1674s1c1
Sequence:CCGGCCACAGGAAGTAGTAAAGCTTCTCGAGAAGCTTTACTACTTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018294.3-589s1c1
Sequence:CCGGGCTTGAAACCAAGATACCATTCTCGAGAATGGTATCTTGGTTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018294.3-1224s1c1
Sequence:CCGGCGAGGGAAATGGTGTGTTGTACTCGAGTACAACACACCATTTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018294.3-460s1c1
Sequence:CCGGCCCAGTTTAAGGGTGTTGATACTCGAGTATCAACACCCTTAAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018294.3-1306s1c1
Sequence:CCGGGCTCTACTACTGATGACATTACTCGAGTAATGTCATCAGTAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018294.4-704s21c1
Sequence:CCGGCATATCGAAACCATATCATTCCTCGAGGAATGATATGGTTTCGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018294
CWF19L1 MISSION shRNA shRNA Plasmid DNA
CWF19-like 1, cell cycle control (S. pombe)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018294.3-1674s1c1
Sequence:CCGGCCACAGGAAGTAGTAAAGCTTCTCGAGAAGCTTTACTACTTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018294.3-589s1c1
Sequence:CCGGGCTTGAAACCAAGATACCATTCTCGAGAATGGTATCTTGGTTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018294.3-1224s1c1
Sequence:CCGGCGAGGGAAATGGTGTGTTGTACTCGAGTACAACACACCATTTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018294.3-460s1c1
Sequence:CCGGCCCAGTTTAAGGGTGTTGATACTCGAGTATCAACACCCTTAAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018294.3-1306s1c1
Sequence:CCGGGCTCTACTACTGATGACATTACTCGAGTAATGTCATCAGTAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018294.4-704s21c1
Sequence:CCGGCATATCGAAACCATATCATTCCTCGAGGAATGATATGGTTTCGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018294
CWF19L1 MISSION shRNA Lentiviral Transduction Particles
CWF19-like 1, cell cycle control (S. pombe)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018294.3-1674s1c1
Sequence:CCGGCCACAGGAAGTAGTAAAGCTTCTCGAGAAGCTTTACTACTTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018294.3-589s1c1
Sequence:CCGGGCTTGAAACCAAGATACCATTCTCGAGAATGGTATCTTGGTTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018294.3-1224s1c1
Sequence:CCGGCGAGGGAAATGGTGTGTTGTACTCGAGTACAACACACCATTTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018294.3-460s1c1
Sequence:CCGGCCCAGTTTAAGGGTGTTGATACTCGAGTATCAACACCCTTAAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018294.3-1306s1c1
Sequence:CCGGGCTCTACTACTGATGACATTACTCGAGTAATGTCATCAGTAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018294.4-704s21c1
Sequence:CCGGCATATCGAAACCATATCATTCCTCGAGGAATGATATGGTTTCGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081077
VALIDATED
CWF19L1 MISSION shRNA Bacterial Glycerol Stock
CWF19-like 1, cell cycle control (S. pombe)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081077.1-152s21c1
Sequence:CCGGTTCAATAGAGTTCGGACAATTCTCGAGAATTGTCCGAACTCTATTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081077.1-509s21c1
Sequence:CCGGTGCTCGGCTTCCCAGTTTAAACTCGAGTTTAAACTGGGAAGCCGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081077.1-238s21c1
Sequence:CCGGTGCTGAGTGGGAGGAGTATAACTCGAGTTATACTCCTCCCACTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081077.1-2448s21c1
Sequence:CCGGACAGAGTTTAGAGTCTAATTTCTCGAGAAATTAGACTCTAAACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081077.1-949s21c1
Sequence:CCGGCTGTCAGTTCTTCTTCGATTTCTCGAGAAATCGAAGAAGAACTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081077
VALIDATED
CWF19L1 MISSION shRNA shRNA Plasmid DNA
CWF19-like 1, cell cycle control (S. pombe)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081077.1-152s21c1
Sequence:CCGGTTCAATAGAGTTCGGACAATTCTCGAGAATTGTCCGAACTCTATTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081077.1-509s21c1
Sequence:CCGGTGCTCGGCTTCCCAGTTTAAACTCGAGTTTAAACTGGGAAGCCGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081077.1-238s21c1
Sequence:CCGGTGCTGAGTGGGAGGAGTATAACTCGAGTTATACTCCTCCCACTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081077.1-2448s21c1
Sequence:CCGGACAGAGTTTAGAGTCTAATTTCTCGAGAAATTAGACTCTAAACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081077.1-949s21c1
Sequence:CCGGCTGTCAGTTCTTCTTCGATTTCTCGAGAAATCGAAGAAGAACTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081077
VALIDATED
CWF19L1 MISSION shRNA Lentiviral Transduction Particles
CWF19-like 1, cell cycle control (S. pombe)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081077.1-152s21c1
Sequence:CCGGTTCAATAGAGTTCGGACAATTCTCGAGAATTGTCCGAACTCTATTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081077.1-509s21c1
Sequence:CCGGTGCTCGGCTTCCCAGTTTAAACTCGAGTTTAAACTGGGAAGCCGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081077.1-238s21c1
Sequence:CCGGTGCTGAGTGGGAGGAGTATAACTCGAGTTATACTCCTCCCACTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081077.1-2448s21c1
Sequence:CCGGACAGAGTTTAGAGTCTAATTTCTCGAGAAATTAGACTCTAAACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081077.1-949s21c1
Sequence:CCGGCTGTCAGTTCTTCTTCGATTTCTCGAGAAATCGAAGAAGAACTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks