EMAIL THIS PAGE TO A FRIEND

CWF19L2

CWF19-like 2, cell cycle control (S. pombe)

46 Gene Product Result for
UniProtKB ID: Q2TBE0, A4FU66, A4FU67, A4FU68, Q6PHW1, Q96MI1
Gene ID:
Mouse(244672) CWF19-like 2, cell cycle control (S. pombe)
Rat(362804) CWF19-like 2, cell cycle control (S. pombe)
domestic guinea pig(100731853) CWF19-like 2, cell cycle control (S. pombe)
naked mole-rat(101703177) CWF19-like 2, cell cycle control (S. pombe)
sheep(101103667) CWF19-like 2, cell cycle control (S. pombe)
Domestic Rabbit(100357362) CWF19-like 2, cell cycle control (S. pombe)
Zebrafish(619271) CWF19-like 2, cell cycle control (S. pombe)
dog(479454) CWF19-like 2, cell cycle control (S. pombe)
domestic cat(101087778) CWF19-like 2, cell cycle control (S. pombe)
cow(522518) CWF19-like 2, cell cycle control (S. pombe)
Horse(100069555) CWF19-like 2, cell cycle control (S. pombe)
chicken(418973) CWF19-like 2, cell cycle control (S. pombe)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA038166 Anti-CWF19L2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152434 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152434 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152434 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027545 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027545 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027545 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152434 Rosetta Predictions human pricing
NM_001135003 Rosetta Predictions rat pricing
NM_027545 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152434 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122408 predicted 2459
2 SASI_Hs02_00366174 predicted 2741
3 SASI_Hs01_00122410 predicted 2412
4 SASI_Hs02_00366175 predicted 1748
5 SASI_Hs02_00366176 predicted 1696
6 SASI_Hs01_00122411 predicted 2546
7 SASI_Hs01_00122412 predicted 715
8 SASI_Hs01_00122414 predicted 2591
9 SASI_Hs01_00122415 predicted 693
10 SASI_Hs01_00122416 predicted 2094
11 SASI_Hs01_00122409 predicted 619
12 SASI_Hs01_00122413 predicted 2019
13 SASI_Hs01_00122417 predicted 995
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001135003 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259377 predicted 1137
2 SASI_Rn02_00259378 predicted 1612
3 SASI_Rn02_00259379 predicted 2312
4 SASI_Rn02_00259380 predicted 1664
5 SASI_Rn02_00259381 predicted 2494
6 SASI_Rn02_00259382 predicted 2352
7 SASI_Rn02_00259383 predicted 2074
8 SASI_Rn02_00259384 predicted 1307
9 SASI_Rn02_00259385 predicted 517
10 SASI_Rn02_00259386 predicted 2461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027545 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078379 predicted 1114
2 SASI_Mm01_00078381 predicted 968
3 SASI_Mm01_00078382 predicted 681
4 SASI_Mm01_00078383 predicted 2320
5 SASI_Mm01_00078384 predicted 2500
6 SASI_Mm01_00078385 predicted 1070
7 SASI_Mm01_00078386 predicted 2538
8 SASI_Mm01_00078387 predicted 1331
9 SASI_Mm01_00078388 predicted 2440
10 SASI_Mm02_00332390 predicted 2366
11 SASI_Mm01_00078380 predicted 2551
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152434
CWF19L2 MISSION shRNA Bacterial Glycerol Stock
CWF19-like 2, cell cycle control (S. pombe)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152434.2-2100s21c1
Sequence:CCGGTGCAATAGGTGTTAAGGTTTACTCGAGTAAACCTTAACACCTATTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152434.2-1810s21c1
Sequence:CCGGGATGATAATCTAAGCCTAAATCTCGAGATTTAGGCTTAGATTATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152434.2-796s21c1
Sequence:CCGGGCCGAAAGATATGGGTCAATGCTCGAGCATTGACCCATATCTTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152434.2-702s21c1
Sequence:CCGGGGTAGAAGATGGTGGATTAAGCTCGAGCTTAATCCACCATCTTCTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152434.1-1843s1c1
Sequence:CCGGGCAGCTACTTTGTTGGATGAACTCGAGTTCATCCAACAAAGTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152434.1-508s1c1
Sequence:CCGGGCATCCACGAAAGAAGATTATCTCGAGATAATCTTCTTTCGTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152434.1-1146s1c1
Sequence:CCGGGAGTGTTGATGAGAAGAACAACTCGAGTTGTTCTTCTCATCAACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134054    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152434.1-2419s1c1
Sequence:CCGGCCATTGCATCTAATGAAGCAACTCGAGTTGCTTCATTAGATGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152434.1-1090s1c1
Sequence:CCGGCGGGATACAAAGTCTACATTTCTCGAGAAATGTAGACTTTGTATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152434.1-247s1c1
Sequence:CCGGGAACAGTCCAAACTGATGGAACTCGAGTTCCATCAGTTTGGACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152434.1-2325s1c1
Sequence:CCGGGTGGTGGAAACCATATGACTTCTCGAGAAGTCATATGGTTTCCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152434
CWF19L2 MISSION shRNA shRNA Plasmid DNA
CWF19-like 2, cell cycle control (S. pombe)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152434.2-2100s21c1
Sequence:CCGGTGCAATAGGTGTTAAGGTTTACTCGAGTAAACCTTAACACCTATTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152434.2-1810s21c1
Sequence:CCGGGATGATAATCTAAGCCTAAATCTCGAGATTTAGGCTTAGATTATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152434.2-796s21c1
Sequence:CCGGGCCGAAAGATATGGGTCAATGCTCGAGCATTGACCCATATCTTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152434.2-702s21c1
Sequence:CCGGGGTAGAAGATGGTGGATTAAGCTCGAGCTTAATCCACCATCTTCTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152434.1-1843s1c1
Sequence:CCGGGCAGCTACTTTGTTGGATGAACTCGAGTTCATCCAACAAAGTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152434.1-508s1c1
Sequence:CCGGGCATCCACGAAAGAAGATTATCTCGAGATAATCTTCTTTCGTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152434.1-1146s1c1
Sequence:CCGGGAGTGTTGATGAGAAGAACAACTCGAGTTGTTCTTCTCATCAACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134054    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152434.1-2419s1c1
Sequence:CCGGCCATTGCATCTAATGAAGCAACTCGAGTTGCTTCATTAGATGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152434.1-1090s1c1
Sequence:CCGGCGGGATACAAAGTCTACATTTCTCGAGAAATGTAGACTTTGTATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152434.1-247s1c1
Sequence:CCGGGAACAGTCCAAACTGATGGAACTCGAGTTCCATCAGTTTGGACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152434.1-2325s1c1
Sequence:CCGGGTGGTGGAAACCATATGACTTCTCGAGAAGTCATATGGTTTCCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152434
CWF19L2 MISSION shRNA Lentiviral Transduction Particles
CWF19-like 2, cell cycle control (S. pombe)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152434.2-2100s21c1
Sequence:CCGGTGCAATAGGTGTTAAGGTTTACTCGAGTAAACCTTAACACCTATTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152434.2-1810s21c1
Sequence:CCGGGATGATAATCTAAGCCTAAATCTCGAGATTTAGGCTTAGATTATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152434.2-796s21c1
Sequence:CCGGGCCGAAAGATATGGGTCAATGCTCGAGCATTGACCCATATCTTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152434.2-702s21c1
Sequence:CCGGGGTAGAAGATGGTGGATTAAGCTCGAGCTTAATCCACCATCTTCTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152434.1-1843s1c1
Sequence:CCGGGCAGCTACTTTGTTGGATGAACTCGAGTTCATCCAACAAAGTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152434.1-508s1c1
Sequence:CCGGGCATCCACGAAAGAAGATTATCTCGAGATAATCTTCTTTCGTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152434.1-1146s1c1
Sequence:CCGGGAGTGTTGATGAGAAGAACAACTCGAGTTGTTCTTCTCATCAACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134054    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152434.1-2419s1c1
Sequence:CCGGCCATTGCATCTAATGAAGCAACTCGAGTTGCTTCATTAGATGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152434.1-1090s1c1
Sequence:CCGGCGGGATACAAAGTCTACATTTCTCGAGAAATGTAGACTTTGTATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152434.1-247s1c1
Sequence:CCGGGAACAGTCCAAACTGATGGAACTCGAGTTCCATCAGTTTGGACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152434.1-2325s1c1
Sequence:CCGGGTGGTGGAAACCATATGACTTCTCGAGAAGTCATATGGTTTCCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027545
VALIDATED
CWF19L2 MISSION shRNA Bacterial Glycerol Stock
CWF19-like 2, cell cycle control (S. pombe)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027545.2-1077s1c1
Sequence:CCGGCTGGAAATTTGAGATCTAAATCTCGAGATTTAGATCTCAAATTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027545.2-431s1c1
Sequence:CCGGGAATGTGACAGCCACGATATTCTCGAGAATATCGTGGCTGTCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027545.1-456s1c1
Sequence:CCGGCGTGATGAGTGGATGACTATTCTCGAGAATAGTCATCCACTCATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027545.1-587s1c1
Sequence:CCGGCGAAAGAGAATTGAATCCATACTCGAGTATGGATTCAATTCTCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027545.1-455s1c1
Sequence:CCGGGCGTGATGAGTGGATGACTATCTCGAGATAGTCATCCACTCATCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027545.1-2710s1c1
Sequence:CCGGCCCATTCAGTTTATGTCTATTCTCGAGAATAGACATAAACTGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027545.1-3520s1c2
Sequence:CCGGCCACAGACTAACTCATTACATCTCGAGATGTAATGAGTTAGTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027545.1-376s1c1
Sequence:CCGGCCCAGATATCTGACAAAGAAACTCGAGTTTCTTTGTCAGATATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027545
VALIDATED
CWF19L2 MISSION shRNA shRNA Plasmid DNA
CWF19-like 2, cell cycle control (S. pombe)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027545.2-1077s1c1
Sequence:CCGGCTGGAAATTTGAGATCTAAATCTCGAGATTTAGATCTCAAATTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027545.2-431s1c1
Sequence:CCGGGAATGTGACAGCCACGATATTCTCGAGAATATCGTGGCTGTCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027545.1-456s1c1
Sequence:CCGGCGTGATGAGTGGATGACTATTCTCGAGAATAGTCATCCACTCATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027545.1-587s1c1
Sequence:CCGGCGAAAGAGAATTGAATCCATACTCGAGTATGGATTCAATTCTCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027545.1-455s1c1
Sequence:CCGGGCGTGATGAGTGGATGACTATCTCGAGATAGTCATCCACTCATCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027545.1-2710s1c1
Sequence:CCGGCCCATTCAGTTTATGTCTATTCTCGAGAATAGACATAAACTGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027545.1-3520s1c2
Sequence:CCGGCCACAGACTAACTCATTACATCTCGAGATGTAATGAGTTAGTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027545.1-376s1c1
Sequence:CCGGCCCAGATATCTGACAAAGAAACTCGAGTTTCTTTGTCAGATATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027545
VALIDATED
CWF19L2 MISSION shRNA Lentiviral Transduction Particles
CWF19-like 2, cell cycle control (S. pombe)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027545.2-1077s1c1
Sequence:CCGGCTGGAAATTTGAGATCTAAATCTCGAGATTTAGATCTCAAATTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027545.2-431s1c1
Sequence:CCGGGAATGTGACAGCCACGATATTCTCGAGAATATCGTGGCTGTCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027545.1-456s1c1
Sequence:CCGGCGTGATGAGTGGATGACTATTCTCGAGAATAGTCATCCACTCATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027545.1-587s1c1
Sequence:CCGGCGAAAGAGAATTGAATCCATACTCGAGTATGGATTCAATTCTCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027545.1-455s1c1
Sequence:CCGGGCGTGATGAGTGGATGACTATCTCGAGATAGTCATCCACTCATCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027545.1-2710s1c1
Sequence:CCGGCCCATTCAGTTTATGTCTATTCTCGAGAATAGACATAAACTGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027545.1-3520s1c2
Sequence:CCGGCCACAGACTAACTCATTACATCTCGAGATGTAATGAGTTAGTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027545.1-376s1c1
Sequence:CCGGCCCAGATATCTGACAAAGAAACTCGAGTTTCTTTGTCAGATATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks