EMAIL THIS PAGE TO A FRIEND

CWH43

cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)

91 Gene Product Result for
Synonyms: CWH43-C
UniProtKB ID: Q9H720, B2RPD7
Gene ID:
Mouse(231293) cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)
Rat(305307) cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)
chicken(422763) cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)
domestic cat(101088079) cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)
cow(785528) cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)
dog(482143) cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)
sheep(101104067) cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)
Domestic Rabbit(100344210) cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)
naked mole-rat(101707354) cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)
domestic guinea pig(100722546) cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181323 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181323 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181323 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025087 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025087 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025087 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU037741 MISSION® esiRNA esiRNA targeting mouse C130090K23Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025087 Rosetta Predictions human pricing
XM_001076815 Rosetta Predictions rat pricing
XM_223359 Rosetta Predictions rat pricing
NM_145560 Rosetta Predictions mouse pricing
NM_181323 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025087 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229828 predicted 1780
2 SASI_Hs01_00229829 predicted 500
3 SASI_Hs02_00357785 predicted 1291
4 SASI_Hs01_00229830 predicted 1392
5 SASI_Hs01_00229831 predicted 614
6 SASI_Hs01_00229832 predicted 345
7 SASI_Hs01_00229833 predicted 943
8 SASI_Hs01_00229834 predicted 1892
9 SASI_Hs02_00357786 predicted 482
10 SASI_Hs01_00229836 predicted 920
11 SASI_Hs01_00229835 predicted 330
12 SASI_Hs01_00229837 predicted 1908
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076815 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00354686 predicted 1791
2 SASI_Rn02_00354687 predicted 640
3 SASI_Rn02_00354688 predicted 1845
4 SASI_Rn02_00354689 predicted 1527
5 SASI_Rn02_00354690 predicted 1881
6 SASI_Rn02_00354691 predicted 451
7 SASI_Rn02_00354692 predicted 593
8 SASI_Rn02_00354693 predicted 2083
9 SASI_Rn02_00354694 predicted 648
10 SASI_Rn02_00354695 predicted 2150
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223359 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381295 predicted 2064
2 SASI_Rn02_00381296 predicted 536
3 SASI_Rn02_00381297 predicted 549
4 SASI_Rn02_00381298 predicted 408
5 SASI_Rn02_00381299 predicted 451
6 SASI_Rn02_00381300 predicted 589
7 SASI_Rn02_00381301 predicted 329
8 SASI_Rn02_00381302 predicted 2078
9 SASI_Rn02_00381303 predicted 379
10 SASI_Rn02_00381304 predicted 2105
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145560 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110357 predicted 1067
2 SASI_Mm01_00110358 predicted 994
3 SASI_Mm01_00110359 predicted 858
4 SASI_Mm01_00110360 predicted 2104
5 SASI_Mm01_00110361 predicted 2132
6 SASI_Mm01_00110362 predicted 1001
7 SASI_Mm01_00110363 predicted 2104
8 SASI_Mm01_00110364 predicted 1118
9 SASI_Mm01_00110365 predicted 1021
10 SASI_Mm01_00110366 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181323 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349677 predicted 1352
2 SASI_Mm02_00349678 predicted 1919
3 SASI_Mm02_00349679 predicted 528
4 SASI_Mm02_00349680 predicted 1869
5 SASI_Mm02_00349681 predicted 1603
6 SASI_Mm02_00349682 predicted 1692
7 SASI_Mm02_00349683 predicted 686
8 SASI_Mm02_00349684 predicted 1370
9 SASI_Mm02_00349685 predicted 2130
10 SASI_Mm02_00349686 predicted 1512
11 SASI_Mm01_00068844 predicted 1235
12 SASI_Mm01_00068845 predicted 1174
13 SASI_Mm01_00068846 predicted 1029
14 SASI_Mm01_00068847 predicted 2279
15 SASI_Mm01_00068848 predicted 2298
16 SASI_Mm01_00068849 predicted 1181
17 SASI_Mm01_00068850 predicted 2282
18 SASI_Mm01_00068851 predicted 1290
19 SASI_Mm01_00068852 predicted 1190
20 SASI_Mm01_00068853 predicted 1091
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181323
CWH43 MISSION shRNA Bacterial Glycerol Stock
cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181323.2-2505s1c1
Sequence:CCGGGCAATGAGAATCCCATCAATTCTCGAGAATTGATGGGATTCTCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181323.2-1742s1c1
Sequence:CCGGGCTGGGTTTCTACACAGACTTCTCGAGAAGTCTGTGTAGAAACCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181323.2-1869s1c1
Sequence:CCGGCCAGCCATAACCATGACAGTTCTCGAGAACTGTCATGGTTATGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181323.2-692s1c1
Sequence:CCGGCCGAATATGGTACACATCATTCTCGAGAATGATGTGTACCATATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181323.2-528s1c1
Sequence:CCGGGCTTCCTTTGAGGCTCCAAATCTCGAGATTTGGAGCCTCAAAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181323
CWH43 MISSION shRNA shRNA Plasmid DNA
cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181323.2-2505s1c1
Sequence:CCGGGCAATGAGAATCCCATCAATTCTCGAGAATTGATGGGATTCTCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181323.2-1742s1c1
Sequence:CCGGGCTGGGTTTCTACACAGACTTCTCGAGAAGTCTGTGTAGAAACCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181323.2-1869s1c1
Sequence:CCGGCCAGCCATAACCATGACAGTTCTCGAGAACTGTCATGGTTATGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181323.2-692s1c1
Sequence:CCGGCCGAATATGGTACACATCATTCTCGAGAATGATGTGTACCATATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181323.2-528s1c1
Sequence:CCGGGCTTCCTTTGAGGCTCCAAATCTCGAGATTTGGAGCCTCAAAGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181323
CWH43 MISSION shRNA Lentiviral Transduction Particles
cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181323.2-2505s1c1
Sequence:CCGGGCAATGAGAATCCCATCAATTCTCGAGAATTGATGGGATTCTCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181323.2-1742s1c1
Sequence:CCGGGCTGGGTTTCTACACAGACTTCTCGAGAAGTCTGTGTAGAAACCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181323.2-1869s1c1
Sequence:CCGGCCAGCCATAACCATGACAGTTCTCGAGAACTGTCATGGTTATGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181323.2-692s1c1
Sequence:CCGGCCGAATATGGTACACATCATTCTCGAGAATGATGTGTACCATATTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181323.2-528s1c1
Sequence:CCGGGCTTCCTTTGAGGCTCCAAATCTCGAGATTTGGAGCCTCAAAGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025087
CWH43 MISSION shRNA Bacterial Glycerol Stock
cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025087.1-2068s1c1
Sequence:CCGGCCCATGCTGAACTGAGTGATTCTCGAGAATCACTCAGTTCAGCATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025087.1-254s1c1
Sequence:CCGGCCTGGGACCGATGATCTATTACTCGAGTAATAGATCATCGGTCCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025087.1-395s1c1
Sequence:CCGGCCTGCTGAGGATAATCACTATCTCGAGATAGTGATTATCCTCAGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025087.1-1968s1c1
Sequence:CCGGGAACATGGCAATGTGAAGGATCTCGAGATCCTTCACATTGCCATGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025087.1-932s1c1
Sequence:CCGGGCTTCCATCTTGTTTGTGGTTCTCGAGAACCACAAACAAGATGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155952    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025087.1-2294s1c1
Sequence:CCGGCAAGAAGTTATTGGCTGGGAACTCGAGTTCCCAGCCAATAACTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025087.2-1127s21c1
Sequence:CCGGCATGACCATTGCCATGATATTCTCGAGAATATCATGGCAATGGTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025087.2-1402s21c1
Sequence:CCGGGATTAGGACTACGGCATAAAGCTCGAGCTTTATGCCGTAGTCCTAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025087.2-1584s21c1
Sequence:CCGGGATGCTTCTAAGCCCTATATGCTCGAGCATATAGGGCTTAGAAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025087
CWH43 MISSION shRNA shRNA Plasmid DNA
cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025087.1-2068s1c1
Sequence:CCGGCCCATGCTGAACTGAGTGATTCTCGAGAATCACTCAGTTCAGCATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025087.1-254s1c1
Sequence:CCGGCCTGGGACCGATGATCTATTACTCGAGTAATAGATCATCGGTCCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025087.1-395s1c1
Sequence:CCGGCCTGCTGAGGATAATCACTATCTCGAGATAGTGATTATCCTCAGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025087.1-1968s1c1
Sequence:CCGGGAACATGGCAATGTGAAGGATCTCGAGATCCTTCACATTGCCATGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025087.1-932s1c1
Sequence:CCGGGCTTCCATCTTGTTTGTGGTTCTCGAGAACCACAAACAAGATGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155952    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025087.1-2294s1c1
Sequence:CCGGCAAGAAGTTATTGGCTGGGAACTCGAGTTCCCAGCCAATAACTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025087.2-1127s21c1
Sequence:CCGGCATGACCATTGCCATGATATTCTCGAGAATATCATGGCAATGGTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025087.2-1402s21c1
Sequence:CCGGGATTAGGACTACGGCATAAAGCTCGAGCTTTATGCCGTAGTCCTAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025087.2-1584s21c1
Sequence:CCGGGATGCTTCTAAGCCCTATATGCTCGAGCATATAGGGCTTAGAAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025087
CWH43 MISSION shRNA Lentiviral Transduction Particles
cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025087.1-2068s1c1
Sequence:CCGGCCCATGCTGAACTGAGTGATTCTCGAGAATCACTCAGTTCAGCATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025087.1-254s1c1
Sequence:CCGGCCTGGGACCGATGATCTATTACTCGAGTAATAGATCATCGGTCCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025087.1-395s1c1
Sequence:CCGGCCTGCTGAGGATAATCACTATCTCGAGATAGTGATTATCCTCAGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025087.1-1968s1c1
Sequence:CCGGGAACATGGCAATGTGAAGGATCTCGAGATCCTTCACATTGCCATGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025087.1-932s1c1
Sequence:CCGGGCTTCCATCTTGTTTGTGGTTCTCGAGAACCACAAACAAGATGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155952    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025087.1-2294s1c1
Sequence:CCGGCAAGAAGTTATTGGCTGGGAACTCGAGTTCCCAGCCAATAACTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025087.2-1127s21c1
Sequence:CCGGCATGACCATTGCCATGATATTCTCGAGAATATCATGGCAATGGTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025087.2-1402s21c1
Sequence:CCGGGATTAGGACTACGGCATAAAGCTCGAGCTTTATGCCGTAGTCCTAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025087.2-1584s21c1
Sequence:CCGGGATGCTTCTAAGCCCTATATGCTCGAGCATATAGGGCTTAGAAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)