EMAIL THIS PAGE TO A FRIEND

CX3CL1

chemokine (C-X3-C motif) ligand 1

77 Gene Product Result for
Synonyms: ABCD-3 C3Xkine CXC3 CXC3C NTN NTT SCYD1 fractalkine neurotactin
UniProtKB ID: P78423, O00672
Gene ID:
Mouse(20312) chemokine (C-X3-C motif) ligand 1
Rat(89808) chemokine (C-X3-C motif) ligand 1
chicken(415651) chemokine (C-X3-C motif) ligand 1
domestic cat(101084670) chemokine (C-X3-C motif) ligand 1
cow(517354) chemokine (C-X3-C motif) ligand 1
dog(487265) chemokine (C-X3-C motif) ligand 1
sheep(101119927) chemokine (C-X3-C motif) ligand 1
domestic guinea pig(100723932) chemokine (C-X3-C motif) ligand 1
naked mole-rat(101698061) chemokine (C-X3-C motif) ligand 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002996 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002996 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002996 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009142 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009142 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009142 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002996 Rosetta Predictions human pricing
NM_134455 Rosetta Predictions rat pricing
NM_009142 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002996 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157501 predicted 1215
2 SASI_Hs01_00157502 predicted 1579
3 SASI_Hs01_00157503 predicted 1271
4 SASI_Hs01_00157504 predicted 1579
5 SASI_Hs01_00157505 predicted 245
6 SASI_Hs01_00157506 predicted 1295
7 SASI_Hs01_00157508 predicted 545
8 SASI_Hs01_00157509 predicted 1163
9 SASI_Hs01_00157510 predicted 196
10 SASI_Hs02_00334872 predicted 1135
11 SASI_Hs01_00157507 predicted 1103
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134455 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094561 predicted 416
2 SASI_Rn01_00094564 predicted 947
3 SASI_Rn01_00094565 predicted 347
4 SASI_Rn01_00094567 predicted 1364
5 SASI_Rn01_00094569 predicted 1226
6 SASI_Rn01_00094570 predicted 1467
7 SASI_Rn02_00268046 predicted 1035
8 SASI_Rn02_00268047 predicted 418
9 SASI_Rn02_00268048 predicted 1668
10 SASI_Rn02_00268049 predicted 972
11 SASI_Rn01_00094562 predicted 208
12 SASI_Rn01_00094563 predicted 233
13 SASI_Rn01_00094566 predicted 1085
14 SASI_Rn01_00094568 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009142 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073980 predicted 1039
2 SASI_Mm01_00073982 predicted 482
3 SASI_Mm02_00315452 predicted 203
4 SASI_Mm01_00073983 predicted 463
5 SASI_Mm01_00073984 predicted 618
6 SASI_Mm01_00073985 predicted 269
7 SASI_Mm01_00073986 predicted 610
8 SASI_Mm02_00315453 predicted 212
9 SASI_Mm01_00073987 predicted 484
10 SASI_Mm01_00073988 predicted 595
11 SASI_Mm01_00073981 predicted 523
12 SASI_Mm01_00073989 predicted 654
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002996
CX3CL1 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X3-C motif) ligand 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002996.3-1269s21c1
Sequence:CCGGTGGCCTGTGTCTAGTTGTTTGCTCGAGCAAACAACTAGACACAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002996.3-344s21c1
Sequence:CCGGGCTGCTGCCCTAACTCGAAATCTCGAGATTTCGAGTTAGGGCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002996.3-1305s21c1
Sequence:CCGGTGGGATCCCTCATCCTCATACCTCGAGGTATGAGGATGAGGGATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002996.3-2529s1c1
Sequence:CCGGCCAGGGATTTCCATGATGTTTCTCGAGAAACATCATGGAAATCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002996.3-1218s1c1
Sequence:CCGGCCCGGAGCTGTGGTAGTAATTCTCGAGAATTACTACCACAGCTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002996.3-186s1c1
Sequence:CCGGCATCAAAGATACCTGTAGCTTCTCGAGAAGCTACAGGTATCTTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002996.3-148s1c1
Sequence:CCGGCGGTGTGACGAAATGCAACATCTCGAGATGTTGCATTTCGTCACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002996.3-203s1c1
Sequence:CCGGGCTTTGCTCATCCACTATCAACTCGAGTTGATAGTGGATGAGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002996
CX3CL1 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X3-C motif) ligand 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002996.3-1269s21c1
Sequence:CCGGTGGCCTGTGTCTAGTTGTTTGCTCGAGCAAACAACTAGACACAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002996.3-344s21c1
Sequence:CCGGGCTGCTGCCCTAACTCGAAATCTCGAGATTTCGAGTTAGGGCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002996.3-1305s21c1
Sequence:CCGGTGGGATCCCTCATCCTCATACCTCGAGGTATGAGGATGAGGGATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002996.3-2529s1c1
Sequence:CCGGCCAGGGATTTCCATGATGTTTCTCGAGAAACATCATGGAAATCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002996.3-1218s1c1
Sequence:CCGGCCCGGAGCTGTGGTAGTAATTCTCGAGAATTACTACCACAGCTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002996.3-186s1c1
Sequence:CCGGCATCAAAGATACCTGTAGCTTCTCGAGAAGCTACAGGTATCTTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002996.3-148s1c1
Sequence:CCGGCGGTGTGACGAAATGCAACATCTCGAGATGTTGCATTTCGTCACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002996.3-203s1c1
Sequence:CCGGGCTTTGCTCATCCACTATCAACTCGAGTTGATAGTGGATGAGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002996
CX3CL1 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X3-C motif) ligand 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002996.3-1269s21c1
Sequence:CCGGTGGCCTGTGTCTAGTTGTTTGCTCGAGCAAACAACTAGACACAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002996.3-344s21c1
Sequence:CCGGGCTGCTGCCCTAACTCGAAATCTCGAGATTTCGAGTTAGGGCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002996.3-1305s21c1
Sequence:CCGGTGGGATCCCTCATCCTCATACCTCGAGGTATGAGGATGAGGGATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002996.3-2529s1c1
Sequence:CCGGCCAGGGATTTCCATGATGTTTCTCGAGAAACATCATGGAAATCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002996.3-1218s1c1
Sequence:CCGGCCCGGAGCTGTGGTAGTAATTCTCGAGAATTACTACCACAGCTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002996.3-186s1c1
Sequence:CCGGCATCAAAGATACCTGTAGCTTCTCGAGAAGCTACAGGTATCTTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002996.3-148s1c1
Sequence:CCGGCGGTGTGACGAAATGCAACATCTCGAGATGTTGCATTTCGTCACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002996.3-203s1c1
Sequence:CCGGGCTTTGCTCATCCACTATCAACTCGAGTTGATAGTGGATGAGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009142
VALIDATED
CX3CL1 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X3-C motif) ligand 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009142.3-166s21c1
Sequence:CCGGCGGCATGACGAAATGCGAAATCTCGAGATTTCGCATTTCGTCATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009142.3-625s21c1
Sequence:CCGGGCCTCAGAGCATTGGAAGTTTCTCGAGAAACTTCCAATGCTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009142.3-1042s21c1
Sequence:CCGGCCAGAAACTGAGTGTGCTTATCTCGAGATAAGCACACTCAGTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009142.3-873s21c1
Sequence:CCGGAGGAGATAAACCCAGTTCATACTCGAGTATGAACTGGGTTTATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009142.3-193s21c1
Sequence:CCGGCGACAAGATGACCTCACGAATCTCGAGATTCGTGAGGTCATCTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009142.2-147s1c1
Sequence:CCGGCGACAAGATGACCTCACGAATCTCGAGATTCGTGAGGTCATCTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009142.2-996s1c1
Sequence:CCGGCCAGAAACTGAGTGTGCTTATCTCGAGATAAGCACACTCAGTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009142.2-579s1c1
Sequence:CCGGGCCTCAGAGCATTGGAAGTTTCTCGAGAAACTTCCAATGCTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009142.2-827s1c1
Sequence:CCGGAGGAGATAAACCCAGTTCATACTCGAGTATGAACTGGGTTTATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009142.2-120s1c1
Sequence:CCGGCGGCATGACGAAATGCGAAATCTCGAGATTTCGCATTTCGTCATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009142
VALIDATED
CX3CL1 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X3-C motif) ligand 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009142.3-166s21c1
Sequence:CCGGCGGCATGACGAAATGCGAAATCTCGAGATTTCGCATTTCGTCATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009142.3-625s21c1
Sequence:CCGGGCCTCAGAGCATTGGAAGTTTCTCGAGAAACTTCCAATGCTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009142.3-1042s21c1
Sequence:CCGGCCAGAAACTGAGTGTGCTTATCTCGAGATAAGCACACTCAGTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009142.3-873s21c1
Sequence:CCGGAGGAGATAAACCCAGTTCATACTCGAGTATGAACTGGGTTTATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009142.3-193s21c1
Sequence:CCGGCGACAAGATGACCTCACGAATCTCGAGATTCGTGAGGTCATCTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009142.2-147s1c1
Sequence:CCGGCGACAAGATGACCTCACGAATCTCGAGATTCGTGAGGTCATCTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009142.2-996s1c1
Sequence:CCGGCCAGAAACTGAGTGTGCTTATCTCGAGATAAGCACACTCAGTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009142.2-579s1c1
Sequence:CCGGGCCTCAGAGCATTGGAAGTTTCTCGAGAAACTTCCAATGCTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009142.2-827s1c1
Sequence:CCGGAGGAGATAAACCCAGTTCATACTCGAGTATGAACTGGGTTTATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009142.2-120s1c1
Sequence:CCGGCGGCATGACGAAATGCGAAATCTCGAGATTTCGCATTTCGTCATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009142
VALIDATED
CX3CL1 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X3-C motif) ligand 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009142.3-166s21c1
Sequence:CCGGCGGCATGACGAAATGCGAAATCTCGAGATTTCGCATTTCGTCATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009142.3-625s21c1
Sequence:CCGGGCCTCAGAGCATTGGAAGTTTCTCGAGAAACTTCCAATGCTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009142.3-1042s21c1
Sequence:CCGGCCAGAAACTGAGTGTGCTTATCTCGAGATAAGCACACTCAGTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009142.3-873s21c1
Sequence:CCGGAGGAGATAAACCCAGTTCATACTCGAGTATGAACTGGGTTTATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009142.3-193s21c1
Sequence:CCGGCGACAAGATGACCTCACGAATCTCGAGATTCGTGAGGTCATCTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009142.2-147s1c1
Sequence:CCGGCGACAAGATGACCTCACGAATCTCGAGATTCGTGAGGTCATCTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009142.2-996s1c1
Sequence:CCGGCCAGAAACTGAGTGTGCTTATCTCGAGATAAGCACACTCAGTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009142.2-579s1c1
Sequence:CCGGGCCTCAGAGCATTGGAAGTTTCTCGAGAAACTTCCAATGCTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009142.2-827s1c1
Sequence:CCGGAGGAGATAAACCCAGTTCATACTCGAGTATGAACTGGGTTTATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009142.2-120s1c1
Sequence:CCGGCGGCATGACGAAATGCGAAATCTCGAGATTTCGCATTTCGTCATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks