EMAIL THIS PAGE TO A FRIEND

CX3CR1

chemokine (C-X3-C motif) receptor 1

67 Gene Product Result for
Synonyms: CCRL1 CMKBRL1 CMKDR1 GPR13 GPRV28 V28
UniProtKB ID: P49238, A0N0N6, B2R5Z4, J3KP17
Gene ID:
Human(1524) Summary: Fractalkine is a transmembrane protein and chemokine involved in the adhesion and migration of leukocytes. The protein encoded by this gene is a receptor for fractalkine. The encoded protein also is a coreceptor for HIV-1, and some variations in this gene lead to increased susceptibility to HIV-1 infection and rapid progression to AIDS. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
Mouse(13051) chemokine (C-X3-C) receptor 1
Rat(171056) chemokine (C-X3-C motif) receptor 1
sheep(101113016) chemokine (C-X3-C motif) receptor 1
Domestic Rabbit(100008874) chemokine (C-X3-C motif) receptor 1
naked mole-rat(101706400) chemokine (C-X3-C motif) receptor 1
domestic guinea pig(100735615) chemokine (C-X3-C motif) receptor 1
chicken(420719) chemokine (C-X3-C motif) receptor 1
cow(100124525) chemokine (C-X3-C motif) receptor 1
domestic cat(101099898) chemokine (C-X3-C motif) receptor 1
dog(485599) chemokine (C-X3-C motif) receptor 1
Gene Class: Cell_Adhesion
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009987 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009987 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009987 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001337 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001337 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001337 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU140721 MISSION® esiRNA esiRNA human CX3CR1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001337 Rosetta Predictions human pricing
NM_133534 Rosetta Predictions rat pricing
NM_009987 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001337 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331649 predicted 1208
2 SASI_Hs01_00076219 predicted 704
3 SASI_Hs01_00076220 predicted 700
4 SASI_Hs02_00331650 predicted 708
5 SASI_Hs01_00076222 predicted 772
6 SASI_Hs01_00076223 predicted 310
7 SASI_Hs01_00076224 predicted 267
8 SASI_Hs01_00076225 predicted 1207
9 SASI_Hs01_00076226 predicted 937
10 SASI_Hs01_00076227 predicted 374
11 SASI_Hs01_00076221 predicted 1098
12 SASI_Hs01_00076228 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133534 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038717 predicted 745
2 SASI_Rn01_00038718 predicted 735
3 SASI_Rn02_00267717 predicted 286
4 SASI_Rn01_00038719 predicted 888
5 SASI_Rn01_00038720 predicted 248
6 SASI_Rn01_00038721 predicted 568
7 SASI_Rn01_00038722 predicted 377
8 SASI_Rn01_00038723 predicted 449
9 SASI_Rn01_00038724 predicted 842
10 SASI_Rn01_00038725 predicted 763
11 SASI_Rn01_00038726 predicted 705
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009987 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105555 predicted 1181
2 SASI_Mm01_00105556 predicted 1313
3 SASI_Mm01_00105557 predicted 574
4 SASI_Mm01_00105558 predicted 1370
5 SASI_Mm01_00105559 predicted 1099
6 SASI_Mm01_00105560 predicted 1316
7 SASI_Mm02_00317592 predicted 821
8 SASI_Mm01_00105561 predicted 988
9 SASI_Mm01_00105562 predicted 1373
10 SASI_Mm01_00105563 predicted 1179
11 SASI_Mm01_00105564 predicted 587
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009987
CX3CR1 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X3-C motif) receptor 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009987.2-1105s1c1
Sequence:CCGGGCAGTTTCACTCACTACACAACTCGAGTTGTGTAGTGAGTGAAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009987.2-699s1c1
Sequence:CCGGCCCTTGCTTATCATGAGCTTTCTCGAGAAAGCTCATGATAAGCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009987.2-584s1c1
Sequence:CCGGGTTCATGTTCACAAAGAGAAACTCGAGTTTCTCTTTGTGAACATGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009987.2-1785s1c1
Sequence:CCGGCCCTTCAGTAACTAGCAGTATCTCGAGATACTGCTAGTTACTGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009987.2-150s1c1
Sequence:CCGGGCCTGTTATTTGGGCGACATTCTCGAGAATGTCGCCCAAATAACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009987.3-996s21c1
Sequence:CCGGATACCTGGGACACCTGTATAGCTCGAGCTATACAGGTGTCCCAGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009987.3-518s21c1
Sequence:CCGGTGCAGCACGGTGTCACCATTACTCGAGTAATGGTGACACCGTGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009987.3-1187s21c1
Sequence:CCGGCAGAGTTCTTGCATCAGATTTCTCGAGAAATCTGATGCAAGAACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009987
CX3CR1 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X3-C motif) receptor 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009987.2-1105s1c1
Sequence:CCGGGCAGTTTCACTCACTACACAACTCGAGTTGTGTAGTGAGTGAAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009987.2-699s1c1
Sequence:CCGGCCCTTGCTTATCATGAGCTTTCTCGAGAAAGCTCATGATAAGCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009987.2-584s1c1
Sequence:CCGGGTTCATGTTCACAAAGAGAAACTCGAGTTTCTCTTTGTGAACATGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009987.2-1785s1c1
Sequence:CCGGCCCTTCAGTAACTAGCAGTATCTCGAGATACTGCTAGTTACTGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009987.2-150s1c1
Sequence:CCGGGCCTGTTATTTGGGCGACATTCTCGAGAATGTCGCCCAAATAACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009987.3-996s21c1
Sequence:CCGGATACCTGGGACACCTGTATAGCTCGAGCTATACAGGTGTCCCAGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009987.3-518s21c1
Sequence:CCGGTGCAGCACGGTGTCACCATTACTCGAGTAATGGTGACACCGTGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009987.3-1187s21c1
Sequence:CCGGCAGAGTTCTTGCATCAGATTTCTCGAGAAATCTGATGCAAGAACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009987
CX3CR1 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X3-C motif) receptor 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009987.2-1105s1c1
Sequence:CCGGGCAGTTTCACTCACTACACAACTCGAGTTGTGTAGTGAGTGAAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009987.2-699s1c1
Sequence:CCGGCCCTTGCTTATCATGAGCTTTCTCGAGAAAGCTCATGATAAGCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009987.2-584s1c1
Sequence:CCGGGTTCATGTTCACAAAGAGAAACTCGAGTTTCTCTTTGTGAACATGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009987.2-1785s1c1
Sequence:CCGGCCCTTCAGTAACTAGCAGTATCTCGAGATACTGCTAGTTACTGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009987.2-150s1c1
Sequence:CCGGGCCTGTTATTTGGGCGACATTCTCGAGAATGTCGCCCAAATAACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009987.3-996s21c1
Sequence:CCGGATACCTGGGACACCTGTATAGCTCGAGCTATACAGGTGTCCCAGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009987.3-518s21c1
Sequence:CCGGTGCAGCACGGTGTCACCATTACTCGAGTAATGGTGACACCGTGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009987.3-1187s21c1
Sequence:CCGGCAGAGTTCTTGCATCAGATTTCTCGAGAAATCTGATGCAAGAACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001337
CX3CR1 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X3-C motif) receptor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001337.2-307s1c1
Sequence:CCGGGCCTTGTCTGATCTGCTGTTTCTCGAGAAACAGCAGATCAGACAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001337.2-2936s1c1
Sequence:CCGGGCTGTGTATCTGATAGCTCTTCTCGAGAAGAGCTATCAGATACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001337.2-189s1c1
Sequence:CCGGGTCCATATTCTACTCCGTCATCTCGAGATGACGGAGTAGAATATGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001337.2-926s1c1
Sequence:CCGGCGGTTGCATTTAGCCATTGTTCTCGAGAACAATGGCTAAATGCAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001337.2-654s1c1
Sequence:CCGGGCTCCGCAATGTGGAAACAAACTCGAGTTTGTTTCCACATTGCGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001337.3-277s21c1
Sequence:CCGGCCAAGAGTGTCACCGACATTTCTCGAGAAATGTCGGTGACACTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001337.3-345s21c1
Sequence:CCGGCCCTTCTGGACTCACTATTTGCTCGAGCAAATAGTGAGTCCAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001337.3-986s21c1
Sequence:CCGGGAAGTTCAGAAGATACCTTTACTCGAGTAAAGGTATCTTCTGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001337.3-1043s21c1
Sequence:CCGGGCGCTCAGTCCACGTTGATTTCTCGAGAAATCAACGTGGACTGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001337
CX3CR1 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X3-C motif) receptor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001337.2-307s1c1
Sequence:CCGGGCCTTGTCTGATCTGCTGTTTCTCGAGAAACAGCAGATCAGACAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001337.2-2936s1c1
Sequence:CCGGGCTGTGTATCTGATAGCTCTTCTCGAGAAGAGCTATCAGATACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001337.2-189s1c1
Sequence:CCGGGTCCATATTCTACTCCGTCATCTCGAGATGACGGAGTAGAATATGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001337.2-926s1c1
Sequence:CCGGCGGTTGCATTTAGCCATTGTTCTCGAGAACAATGGCTAAATGCAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001337.2-654s1c1
Sequence:CCGGGCTCCGCAATGTGGAAACAAACTCGAGTTTGTTTCCACATTGCGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001337.3-277s21c1
Sequence:CCGGCCAAGAGTGTCACCGACATTTCTCGAGAAATGTCGGTGACACTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001337.3-345s21c1
Sequence:CCGGCCCTTCTGGACTCACTATTTGCTCGAGCAAATAGTGAGTCCAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001337.3-986s21c1
Sequence:CCGGGAAGTTCAGAAGATACCTTTACTCGAGTAAAGGTATCTTCTGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001337.3-1043s21c1
Sequence:CCGGGCGCTCAGTCCACGTTGATTTCTCGAGAAATCAACGTGGACTGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001337
CX3CR1 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X3-C motif) receptor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001337.2-307s1c1
Sequence:CCGGGCCTTGTCTGATCTGCTGTTTCTCGAGAAACAGCAGATCAGACAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001337.2-2936s1c1
Sequence:CCGGGCTGTGTATCTGATAGCTCTTCTCGAGAAGAGCTATCAGATACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001337.2-189s1c1
Sequence:CCGGGTCCATATTCTACTCCGTCATCTCGAGATGACGGAGTAGAATATGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001337.2-926s1c1
Sequence:CCGGCGGTTGCATTTAGCCATTGTTCTCGAGAACAATGGCTAAATGCAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001337.2-654s1c1
Sequence:CCGGGCTCCGCAATGTGGAAACAAACTCGAGTTTGTTTCCACATTGCGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001337.3-277s21c1
Sequence:CCGGCCAAGAGTGTCACCGACATTTCTCGAGAAATGTCGGTGACACTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001337.3-345s21c1
Sequence:CCGGCCCTTCTGGACTCACTATTTGCTCGAGCAAATAGTGAGTCCAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001337.3-986s21c1
Sequence:CCGGGAAGTTCAGAAGATACCTTTACTCGAGTAAAGGTATCTTCTGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001337.3-1043s21c1
Sequence:CCGGGCGCTCAGTCCACGTTGATTTCTCGAGAAATCAACGTGGACTGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks