EMAIL THIS PAGE TO A FRIEND

CXADR

coxsackie virus and adenovirus receptor

116 Gene Product Result for
Synonyms: CAR CAR4/6 HCAR
Gene ID:
Human(1525) Summary: The protein encoded by this gene is a type I membrane receptor for group B coxsackieviruses and subgroup C adenoviruses. Several transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene are found on chromosomes 15, 18, and 21. [provided by RefSeq, May 2011]
Mouse(13052) coxsackie virus and adenovirus receptor
Rat(89843) coxsackie virus and adenovirus receptor
Zebrafish(791793) coxsackie virus and adenovirus receptor
cow(281733) coxsackie virus and adenovirus receptor
domestic cat(101090039) coxsackie virus and adenovirus receptor
chicken(418473) coxsackie virus and adenovirus receptor
dog(403772) coxsackie virus and adenovirus receptor
domestic guinea pig(100729539) coxsackie virus and adenovirus receptor
naked mole-rat(101716109) coxsackie virus and adenovirus receptor
sheep(101116618) coxsackie virus and adenovirus receptor
Domestic Rabbit(100008955) coxsackie virus and adenovirus receptor
Domestic Rabbit(100302411) coxsackie virus and adenovirus receptor
Gene Class: Cell_Adhesion
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1401 Human CXADR ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001338 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001338 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001338 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009988 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009988 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009988 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU096301 MISSION® esiRNA esiRNA human CXADR (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001338 Rosetta Predictions human pricing
NM_053570 Rosetta Predictions rat pricing
NM_001025192 Rosetta Predictions mouse pricing
NM_009988 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001338 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331651 predicted 820
2 SASI_Hs02_00331652 predicted 988
3 SASI_Hs02_00331653 predicted 513
4 SASI_Hs02_00331654 predicted 502
5 SASI_Hs02_00331655 predicted 670
6 SASI_Hs02_00331656 predicted 988
7 SASI_Hs02_00331657 predicted 283
8 SASI_Hs02_00331658 predicted 410
9 SASI_Hs02_00331659 predicted 448
10 SASI_Hs02_00331660 predicted 417
11 SASI_Hs01_00199964 predicted 437
12 SASI_Hs01_00199965 predicted 1219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053570 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069039 predicted 1134
2 SASI_Rn01_00069040 predicted 403
3 SASI_Rn01_00069041 predicted 522
4 SASI_Rn01_00069042 predicted 996
5 SASI_Rn01_00069043 predicted 389
6 SASI_Rn01_00069044 predicted 642
7 SASI_Rn01_00069045 predicted 251
8 SASI_Rn01_00069046 predicted 633
9 SASI_Rn01_00069047 predicted 1112
10 SASI_Rn01_00069048 predicted 997
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025192 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058555 predicted 481
2 SASI_Mm01_00058556 predicted 324
3 SASI_Mm01_00058557 predicted 529
4 SASI_Mm01_00058558 predicted 241
5 SASI_Mm01_00058559 predicted 551
6 SASI_Mm01_00058560 predicted 712
7 SASI_Mm01_00058561 predicted 577
8 SASI_Mm01_00058562 predicted 460
9 SASI_Mm01_00058563 predicted 581
10 SASI_Mm01_00058564 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009988 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156141 predicted 490
2 SASI_Mm01_00156142 predicted 318
3 SASI_Mm01_00156143 predicted 528
4 SASI_Mm01_00156144 predicted 246
5 SASI_Mm01_00156145 predicted 551
6 SASI_Mm01_00156146 predicted 716
7 SASI_Mm01_00156147 predicted 577
8 SASI_Mm01_00156148 predicted 456
9 SASI_Mm01_00156149 predicted 584
10 SASI_Mm01_00156150 predicted 758
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001338
VALIDATED
CXADR MISSION shRNA Bacterial Glycerol Stock
coxsackie virus and adenovirus receptor
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001338.3-396s21c1
Sequence:CCGGTTACGAGTAATGATCTCAAATCTCGAGATTTGAGATCATTACTCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001338.3-2061s21c1
Sequence:CCGGCATAGTTCCCAGGTGATATTTCTCGAGAAATATCACCTGGGAACTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_001338.3-1195s21c1
Sequence:CCGGCAAGGATGGGTCTATAGTATACTCGAGTATACTATAGACCCATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001338.3-781s21c1
Sequence:CCGGTCAGTGCCTGTTGCGTCTAAACTCGAGTTTAGACGCAACAGGCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001338.3-992s21c1
Sequence:CCGGAGAAGCTACATCGGCAGTAATCTCGAGATTACTGCCGATGTAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001338.3-812s1c1
Sequence:CCGGCCTTCAAATAAAGCTGGACTACTCGAGTAGTCCAGCTTTATTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001338.3-168s1c1
Sequence:CCGGCCAGAAGTTTGAGTATCACTACTCGAGTAGTGATACTCAAACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001338.3-671s1c1
Sequence:CCGGCCCACTTCATGGTTAGCAGAACTCGAGTTCTGCTAACCATGAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001338.3-549s1c1
Sequence:CCGGCGAGATGTTACGTTGATGGATCTCGAGATCCATCAACGTAACATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001338.3-1075s1c1
Sequence:CCGGCCAAGTACCAAGTGAAGACTTCTCGAGAAGTCTTCACTTGGTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001338
VALIDATED
CXADR MISSION shRNA shRNA Plasmid DNA
coxsackie virus and adenovirus receptor
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001338.3-396s21c1
Sequence:CCGGTTACGAGTAATGATCTCAAATCTCGAGATTTGAGATCATTACTCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001338.3-2061s21c1
Sequence:CCGGCATAGTTCCCAGGTGATATTTCTCGAGAAATATCACCTGGGAACTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_001338.3-1195s21c1
Sequence:CCGGCAAGGATGGGTCTATAGTATACTCGAGTATACTATAGACCCATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001338.3-781s21c1
Sequence:CCGGTCAGTGCCTGTTGCGTCTAAACTCGAGTTTAGACGCAACAGGCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001338.3-992s21c1
Sequence:CCGGAGAAGCTACATCGGCAGTAATCTCGAGATTACTGCCGATGTAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001338.3-812s1c1
Sequence:CCGGCCTTCAAATAAAGCTGGACTACTCGAGTAGTCCAGCTTTATTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001338.3-168s1c1
Sequence:CCGGCCAGAAGTTTGAGTATCACTACTCGAGTAGTGATACTCAAACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001338.3-671s1c1
Sequence:CCGGCCCACTTCATGGTTAGCAGAACTCGAGTTCTGCTAACCATGAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001338.3-549s1c1
Sequence:CCGGCGAGATGTTACGTTGATGGATCTCGAGATCCATCAACGTAACATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001338.3-1075s1c1
Sequence:CCGGCCAAGTACCAAGTGAAGACTTCTCGAGAAGTCTTCACTTGGTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001338
VALIDATED
CXADR MISSION shRNA Lentiviral Transduction Particles
coxsackie virus and adenovirus receptor
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001338.3-396s21c1
Sequence:CCGGTTACGAGTAATGATCTCAAATCTCGAGATTTGAGATCATTACTCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001338.3-2061s21c1
Sequence:CCGGCATAGTTCCCAGGTGATATTTCTCGAGAAATATCACCTGGGAACTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_001338.3-1195s21c1
Sequence:CCGGCAAGGATGGGTCTATAGTATACTCGAGTATACTATAGACCCATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001338.3-781s21c1
Sequence:CCGGTCAGTGCCTGTTGCGTCTAAACTCGAGTTTAGACGCAACAGGCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001338.3-992s21c1
Sequence:CCGGAGAAGCTACATCGGCAGTAATCTCGAGATTACTGCCGATGTAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001338.3-812s1c1
Sequence:CCGGCCTTCAAATAAAGCTGGACTACTCGAGTAGTCCAGCTTTATTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001338.3-168s1c1
Sequence:CCGGCCAGAAGTTTGAGTATCACTACTCGAGTAGTGATACTCAAACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001338.3-671s1c1
Sequence:CCGGCCCACTTCATGGTTAGCAGAACTCGAGTTCTGCTAACCATGAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001338.3-549s1c1
Sequence:CCGGCGAGATGTTACGTTGATGGATCTCGAGATCCATCAACGTAACATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001338.3-1075s1c1
Sequence:CCGGCCAAGTACCAAGTGAAGACTTCTCGAGAAGTCTTCACTTGGTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009988
VALIDATED
CXADR MISSION shRNA Bacterial Glycerol Stock
coxsackie virus and adenovirus receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009988.2-2742s1c1
Sequence:CCGGGCAAAGTTATAGTGTCAGTTTCTCGAGAAACTGACACTATAACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009988.2-644s1c1
Sequence:CCGGCCCTTCCACTACAGTTTGAATCTCGAGATTCAAACTGTAGTGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009988.2-191s1c1
Sequence:CCGGCCAGTGGTTTGAGCATCACTACTCGAGTAGTGATGCTCAAACCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009988.2-1178s1c1
Sequence:CCGGCCGATGGCATTACAGTGGTATCTCGAGATACCACTGTAATGCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009988.2-251s1c1
Sequence:CCGGCGTATCTACCATGCAAGTTTACTCGAGTAAACTTGCATGGTAGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009988
VALIDATED
CXADR MISSION shRNA shRNA Plasmid DNA
coxsackie virus and adenovirus receptor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009988.2-2742s1c1
Sequence:CCGGGCAAAGTTATAGTGTCAGTTTCTCGAGAAACTGACACTATAACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009988.2-644s1c1
Sequence:CCGGCCCTTCCACTACAGTTTGAATCTCGAGATTCAAACTGTAGTGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009988.2-191s1c1
Sequence:CCGGCCAGTGGTTTGAGCATCACTACTCGAGTAGTGATGCTCAAACCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009988.2-1178s1c1
Sequence:CCGGCCGATGGCATTACAGTGGTATCTCGAGATACCACTGTAATGCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009988.2-251s1c1
Sequence:CCGGCGTATCTACCATGCAAGTTTACTCGAGTAAACTTGCATGGTAGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009988
VALIDATED
CXADR MISSION shRNA Lentiviral Transduction Particles
coxsackie virus and adenovirus receptor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009988.2-2742s1c1
Sequence:CCGGGCAAAGTTATAGTGTCAGTTTCTCGAGAAACTGACACTATAACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009988.2-644s1c1
Sequence:CCGGCCCTTCCACTACAGTTTGAATCTCGAGATTCAAACTGTAGTGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009988.2-191s1c1
Sequence:CCGGCCAGTGGTTTGAGCATCACTACTCGAGTAGTGATGCTCAAACCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009988.2-1178s1c1
Sequence:CCGGCCGATGGCATTACAGTGGTATCTCGAGATACCACTGTAATGCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009988.2-251s1c1
Sequence:CCGGCGTATCTACCATGCAAGTTTACTCGAGTAAACTTGCATGGTAGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks