EMAIL THIS PAGE TO A FRIEND

CXCL10

chemokine (C-X-C motif) ligand 10

104 Gene Product Result for
Synonyms: C7 IFI10 INP10 IP-10 SCYB10 crg-2 gIP-10 mob-1
UniProtKB ID: P02778, Q96QJ5
Gene ID:
Human(3627) Summary: This gene encodes a chemokine of the CXC subfamily and ligand for the receptor CXCR3. Binding of this protein to CXCR3 results in pleiotropic effects, including stimulation of monocytes, natural killer and T-cell migration, and modulation of adhesion molecule expression. [provided by RefSeq, Jul 2008]
Mouse(15945) chemokine (C-X-C motif) ligand 10
Rat(245920) chemokine (C-X-C motif) ligand 10
naked mole-rat(101717531) chemokine (C-X-C motif) ligand 10
domestic guinea pig(100714889) chemokine (C-X-C motif) ligand 10
sheep(442997) chemokine (C-X-C motif) ligand 10
cow(615107) chemokine (C-X-C motif) ligand 10
Horse(100050993) chemokine (C-X-C motif) ligand 10
domestic cat(101100131) chemokine (C-X-C motif) ligand 10
dog(478432) chemokine (C-X-C motif) ligand 10
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021274 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021274 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021274 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001565 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001565 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001565 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001565 Rosetta Predictions human pricing
NM_139089 Rosetta Predictions rat pricing
NM_021274 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001565 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332133 predicted 497
2 SASI_Hs01_00129749 predicted 292
3 SASI_Hs01_00129750 predicted 557
4 SASI_Hs02_00332134 predicted 333
5 SASI_Hs01_00129752 predicted 525
6 SASI_Hs01_00129753 predicted 441
7 SASI_Hs01_00129754 predicted 634
8 SASI_Hs02_00332135 predicted 444
9 SASI_Hs01_00129755 predicted 541
10 SASI_Hs02_00332136 predicted 435
11 SASI_Hs01_00129746 predicted 312
12 SASI_Hs01_00129747 predicted 510
13 SASI_Hs01_00129748 predicted 326
14 SASI_Hs01_00129751 predicted 560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139089 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095349 predicted 874
2 SASI_Rn01_00095351 predicted 795
3 SASI_Rn01_00095352 predicted 779
4 SASI_Rn01_00095353 predicted 525
5 SASI_Rn01_00095354 predicted 737
6 SASI_Rn01_00095355 predicted 652
7 SASI_Rn01_00095357 predicted 415
8 SASI_Rn01_00095358 predicted 804
9 SASI_Rn02_00268455 predicted 863
10 SASI_Rn02_00268456 predicted 636
11 SASI_Rn01_00095350 predicted 466
12 SASI_Rn01_00095356 predicted 576
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021274 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117213 predicted 750
2 SASI_Mm01_00117215 predicted 275
3 SASI_Mm01_00117216 predicted 595
4 SASI_Mm01_00117217 predicted 408
5 SASI_Mm01_00117218 predicted 212
6 SASI_Mm01_00117219 predicted 599
7 SASI_Mm01_00117220 predicted 199
8 SASI_Mm01_00117221 predicted 240
9 SASI_Mm01_00117222 predicted 283
10 SASI_Mm02_00325797 predicted 267
11 SASI_Mm01_00117214 predicted 750
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021274
VALIDATED
CXCL10 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) ligand 10
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021274.1-185s21c1
Sequence:CCGGGAAATCATCCCTGCGAGCCTACTCGAGTAGGCTCGCAGGGATGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021274.1-247s21c1
Sequence:CCGGTGATGAGCAGAGATGTCTGAACTCGAGTTCAGACATCTCTGCTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021274.1-146s21c1
Sequence:CCGGGATGACGGGCCAGTGAGAATGCTCGAGCATTCTCACTGGCCCGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021274.1-276s21c1
Sequence:CCGGCTAAGACCATCAAGAATTTAACTCGAGTTAAATTCTTGATGGTCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021274.1-289s21c1
Sequence:CCGGGAATTTAATGAAAGCGTTTAGCTCGAGCTAAACGCTTTCATTAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021274.1-756s21c1
Sequence:CCGGAGTTTGTAAGCACGAACTTAACTCGAGTTAAGTTCGTGCTTACAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021274.1-221s21c1
Sequence:CCGGGAGATCATTGCCACGATGAAACTCGAGTTTCATCGTGGCAATGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021274.1-329s21c1
Sequence:CCGGGCTCCTTAACTGGAGTGAAGCCTCGAGGCTTCACTCCAGTTAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021274.1-210s21c1
Sequence:CCGGGCCCACGTGTTGAGATCATTGCTCGAGCAATGATCTCAACACGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021274.1-132s21c1
Sequence:CCGGACTGCATCCATATCGATGACGCTCGAGCGTCATCGATATGGATGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021274.1-895s1c1
Sequence:CCGGGCATTGTATATGGAAGAACTTCTCGAGAAGTTCTTCCATATACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021274.1-124s1c1
Sequence:CCGGCCGCTGCAACTGCATCCATATCTCGAGATATGGATGCAGTTGCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021274.1-154s1c1
Sequence:CCGGGCCAGTGAGAATGAGGGCCATCTCGAGATGGCCCTCATTCTCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021274.1-268s1c1
Sequence:CCGGTCCGGAATCTAAGACCATCAACTCGAGTTGATGGTCTTAGATTCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021274.1-258s1c1
Sequence:CCGGGATGTCTGAATCCGGAATCTACTCGAGTAGATTCCGGATTCAGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021274
VALIDATED
CXCL10 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) ligand 10
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021274.1-185s21c1
Sequence:CCGGGAAATCATCCCTGCGAGCCTACTCGAGTAGGCTCGCAGGGATGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021274.1-247s21c1
Sequence:CCGGTGATGAGCAGAGATGTCTGAACTCGAGTTCAGACATCTCTGCTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021274.1-146s21c1
Sequence:CCGGGATGACGGGCCAGTGAGAATGCTCGAGCATTCTCACTGGCCCGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021274.1-276s21c1
Sequence:CCGGCTAAGACCATCAAGAATTTAACTCGAGTTAAATTCTTGATGGTCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021274.1-289s21c1
Sequence:CCGGGAATTTAATGAAAGCGTTTAGCTCGAGCTAAACGCTTTCATTAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021274.1-756s21c1
Sequence:CCGGAGTTTGTAAGCACGAACTTAACTCGAGTTAAGTTCGTGCTTACAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021274.1-221s21c1
Sequence:CCGGGAGATCATTGCCACGATGAAACTCGAGTTTCATCGTGGCAATGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021274.1-329s21c1
Sequence:CCGGGCTCCTTAACTGGAGTGAAGCCTCGAGGCTTCACTCCAGTTAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021274.1-210s21c1
Sequence:CCGGGCCCACGTGTTGAGATCATTGCTCGAGCAATGATCTCAACACGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021274.1-132s21c1
Sequence:CCGGACTGCATCCATATCGATGACGCTCGAGCGTCATCGATATGGATGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021274.1-895s1c1
Sequence:CCGGGCATTGTATATGGAAGAACTTCTCGAGAAGTTCTTCCATATACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021274.1-124s1c1
Sequence:CCGGCCGCTGCAACTGCATCCATATCTCGAGATATGGATGCAGTTGCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021274.1-154s1c1
Sequence:CCGGGCCAGTGAGAATGAGGGCCATCTCGAGATGGCCCTCATTCTCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021274.1-268s1c1
Sequence:CCGGTCCGGAATCTAAGACCATCAACTCGAGTTGATGGTCTTAGATTCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021274.1-258s1c1
Sequence:CCGGGATGTCTGAATCCGGAATCTACTCGAGTAGATTCCGGATTCAGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021274
VALIDATED
CXCL10 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) ligand 10
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021274.1-185s21c1
Sequence:CCGGGAAATCATCCCTGCGAGCCTACTCGAGTAGGCTCGCAGGGATGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021274.1-247s21c1
Sequence:CCGGTGATGAGCAGAGATGTCTGAACTCGAGTTCAGACATCTCTGCTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021274.1-146s21c1
Sequence:CCGGGATGACGGGCCAGTGAGAATGCTCGAGCATTCTCACTGGCCCGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021274.1-276s21c1
Sequence:CCGGCTAAGACCATCAAGAATTTAACTCGAGTTAAATTCTTGATGGTCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021274.1-289s21c1
Sequence:CCGGGAATTTAATGAAAGCGTTTAGCTCGAGCTAAACGCTTTCATTAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021274.1-756s21c1
Sequence:CCGGAGTTTGTAAGCACGAACTTAACTCGAGTTAAGTTCGTGCTTACAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021274.1-221s21c1
Sequence:CCGGGAGATCATTGCCACGATGAAACTCGAGTTTCATCGTGGCAATGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021274.1-329s21c1
Sequence:CCGGGCTCCTTAACTGGAGTGAAGCCTCGAGGCTTCACTCCAGTTAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021274.1-210s21c1
Sequence:CCGGGCCCACGTGTTGAGATCATTGCTCGAGCAATGATCTCAACACGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021274.1-132s21c1
Sequence:CCGGACTGCATCCATATCGATGACGCTCGAGCGTCATCGATATGGATGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021274.1-895s1c1
Sequence:CCGGGCATTGTATATGGAAGAACTTCTCGAGAAGTTCTTCCATATACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021274.1-124s1c1
Sequence:CCGGCCGCTGCAACTGCATCCATATCTCGAGATATGGATGCAGTTGCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021274.1-154s1c1
Sequence:CCGGGCCAGTGAGAATGAGGGCCATCTCGAGATGGCCCTCATTCTCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021274.1-268s1c1
Sequence:CCGGTCCGGAATCTAAGACCATCAACTCGAGTTGATGGTCTTAGATTCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021274.1-258s1c1
Sequence:CCGGGATGTCTGAATCCGGAATCTACTCGAGTAGATTCCGGATTCAGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001565
CXCL10 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) ligand 10
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001565.2-240s21c1
Sequence:CCGGGTCCACGTGTTGAGATCATTGCTCGAGCAATGATCTCAACACGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001565.2-580s21c1
Sequence:CCGGACTCTACCCTGGCACTATAATCTCGAGATTATAGTGCCAGGGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001565.2-451s21c1
Sequence:CCGGGTATATGTCAAGCCATAATTGCTCGAGCAATTATGGCTTGACATATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001565.1-167s1c1
Sequence:CCGGGCATTAGTAATCAACCTGTTACTCGAGTAACAGGTTGATTACTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001565.1-291s1c1
Sequence:CCGGGAATCCAGAATCGAAGGCCATCTCGAGATGGCCTTCGATTCTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001565.1-181s1c1
Sequence:CCGGCCTGTTAATCCAAGGTCTTTACTCGAGTAAAGACCTTGGATTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001565.1-95s1c1
Sequence:CCGGGCCTTATCTTTCTGACTCTAACTCGAGTTAGAGTCAGAAAGATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001565
CXCL10 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) ligand 10
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001565.2-240s21c1
Sequence:CCGGGTCCACGTGTTGAGATCATTGCTCGAGCAATGATCTCAACACGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001565.2-580s21c1
Sequence:CCGGACTCTACCCTGGCACTATAATCTCGAGATTATAGTGCCAGGGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001565.2-451s21c1
Sequence:CCGGGTATATGTCAAGCCATAATTGCTCGAGCAATTATGGCTTGACATATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001565.1-167s1c1
Sequence:CCGGGCATTAGTAATCAACCTGTTACTCGAGTAACAGGTTGATTACTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001565.1-291s1c1
Sequence:CCGGGAATCCAGAATCGAAGGCCATCTCGAGATGGCCTTCGATTCTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001565.1-181s1c1
Sequence:CCGGCCTGTTAATCCAAGGTCTTTACTCGAGTAAAGACCTTGGATTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001565.1-95s1c1
Sequence:CCGGGCCTTATCTTTCTGACTCTAACTCGAGTTAGAGTCAGAAAGATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001565
CXCL10 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) ligand 10
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001565.2-240s21c1
Sequence:CCGGGTCCACGTGTTGAGATCATTGCTCGAGCAATGATCTCAACACGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001565.2-580s21c1
Sequence:CCGGACTCTACCCTGGCACTATAATCTCGAGATTATAGTGCCAGGGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001565.2-451s21c1
Sequence:CCGGGTATATGTCAAGCCATAATTGCTCGAGCAATTATGGCTTGACATATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001565.1-167s1c1
Sequence:CCGGGCATTAGTAATCAACCTGTTACTCGAGTAACAGGTTGATTACTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001565.1-291s1c1
Sequence:CCGGGAATCCAGAATCGAAGGCCATCTCGAGATGGCCTTCGATTCTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001565.1-181s1c1
Sequence:CCGGCCTGTTAATCCAAGGTCTTTACTCGAGTAAAGACCTTGGATTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001565.1-95s1c1
Sequence:CCGGGCCTTATCTTTCTGACTCTAACTCGAGTTAGAGTCAGAAAGATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks