EMAIL THIS PAGE TO A FRIEND

CXCL11

chemokine (C-X-C motif) ligand 11

92 Gene Product Result for
Synonyms: H174 I-TAC IP-9 IP9 SCYB11 SCYB9B b-R1
UniProtKB ID: O14625, Q53YA3, Q92840
Gene ID:
Human(6373) Summary: Chemokines are a group of small (approximately 8 to 14 kD), mostly basic, structurally related molecules that regulate cell trafficking of various types of leukocytes through interactions with a subset of 7-transmembrane, G protein-coupled receptors. Chemokines also play fundamental roles in the development, homeostasis, and function of the immune system, and they have effects on cells of the central nervous system as well as on endothelial cells involved in angiogenesis or angiostasis. Chemokines are divided into 2 major subfamilies, CXC and CC. This gene is a CXC member of the chemokine superfamily. Its encoded protein induces a chemotactic response in activated T-cells and is the dominant ligand for CXC receptor-3. The gene encoding this protein contains 4 exons and at least three polyadenylation signals which might reflect cell-specific regulation of expression. IFN-gamma is a potent inducer of transcription of this gene. [provided by RefSeq, Jul 2008]
Mouse(56066) chemokine (C-X-C motif) ligand 11
Rat(305236) chemokine (C-X-C motif) ligand 11
domestic cat(101099880) chemokine (C-X-C motif) ligand 11
cow(516104) chemokine (C-X-C motif) ligand 11
Horse(100629807) chemokine (C-X-C motif) ligand 11
dog(100685916) chemokine (C-X-C motif) ligand 11
sheep(101108750) chemokine (C-X-C motif) ligand 11
domestic guinea pig(100715176) chemokine (C-X-C motif) ligand 11
naked mole-rat(101697728) chemokine (C-X-C motif) ligand 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005409 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005409 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005409 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019494 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019494 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019494 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005409 Rosetta Predictions human pricing
NM_182952 Rosetta Predictions rat pricing
NM_019494 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005409 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339534 predicted 556
2 SASI_Hs01_00168810 predicted 792
3 SASI_Hs01_00168811 predicted 330
4 SASI_Hs02_00339535 predicted 659
5 SASI_Hs01_00168812 predicted 750
6 SASI_Hs01_00168813 predicted 857
7 SASI_Hs01_00168814 predicted 431
8 SASI_Hs01_00168815 predicted 305
9 SASI_Hs01_00168816 predicted 868
10 SASI_Hs01_00168817 predicted 639
11 SASI_Hs01_00168818 predicted 738
12 SASI_Hs01_00168819 predicted 845
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182952 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091728 predicted 353
2 SASI_Rn01_00091729 predicted 536
3 SASI_Rn01_00091730 predicted 536
4 SASI_Rn01_00091731 predicted 216
5 SASI_Rn01_00091732 predicted 469
6 SASI_Rn01_00091733 predicted 408
7 SASI_Rn01_00091734 predicted 498
8 SASI_Rn01_00091735 predicted 606
9 SASI_Rn01_00091736 predicted 701
10 SASI_Rn02_00269867 predicted 227
11 SASI_Rn01_00091727 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019494 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324517 predicted 555
2 SASI_Mm02_00324518 predicted 294
3 SASI_Mm02_00324519 predicted 451
4 SASI_Mm02_00324520 predicted 378
5 SASI_Mm02_00324521 predicted 223
6 SASI_Mm02_00324522 predicted 306
7 SASI_Mm02_00324523 predicted 314
8 SASI_Mm02_00324524 predicted 642
9 SASI_Mm02_00324525 predicted 204
10 SASI_Mm02_00324526 predicted 443
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005409
CXCL11 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) ligand 11
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005409.3-274s1c1
Sequence:CCGGGAAGTGATTATTACCCTGAAACTCGAGTTTCAGGGTAATAATCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005409.3-124s1c1
Sequence:CCGGGCTGTGATATTGTGTGCTACACTCGAGTGTAGCACACAATATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005409.3-330s21c1
Sequence:CCGGGAAGCAAGCAAGGCTTATAATCTCGAGATTATAAGCCTTGCTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005409.3-849s21c1
Sequence:CCGGACAGTGGAGACATTGACATTACTCGAGTAATGTCAATGTCTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005409.3-658s21c1
Sequence:CCGGGCTGGTTACCATCGGAGTTTACTCGAGTAAACTCCGATGGTAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005409
CXCL11 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) ligand 11
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005409.3-274s1c1
Sequence:CCGGGAAGTGATTATTACCCTGAAACTCGAGTTTCAGGGTAATAATCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005409.3-124s1c1
Sequence:CCGGGCTGTGATATTGTGTGCTACACTCGAGTGTAGCACACAATATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005409.3-330s21c1
Sequence:CCGGGAAGCAAGCAAGGCTTATAATCTCGAGATTATAAGCCTTGCTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005409.3-849s21c1
Sequence:CCGGACAGTGGAGACATTGACATTACTCGAGTAATGTCAATGTCTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005409.3-658s21c1
Sequence:CCGGGCTGGTTACCATCGGAGTTTACTCGAGTAAACTCCGATGGTAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005409
CXCL11 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) ligand 11
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005409.3-274s1c1
Sequence:CCGGGAAGTGATTATTACCCTGAAACTCGAGTTTCAGGGTAATAATCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005409.3-124s1c1
Sequence:CCGGGCTGTGATATTGTGTGCTACACTCGAGTGTAGCACACAATATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005409.3-330s21c1
Sequence:CCGGGAAGCAAGCAAGGCTTATAATCTCGAGATTATAAGCCTTGCTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005409.3-849s21c1
Sequence:CCGGACAGTGGAGACATTGACATTACTCGAGTAATGTCAATGTCTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005409.3-658s21c1
Sequence:CCGGGCTGGTTACCATCGGAGTTTACTCGAGTAAACTCCGATGGTAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019494
CXCL11 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) ligand 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019494.1-310s1c1
Sequence:CCGGCGCCTCATAATGCAGGCAATACTCGAGTATTGCCTGCATTATGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019494.1-121s1c1
Sequence:CCGGCAAGGCTTCCTTATGTTCAAACTCGAGTTTGAACATAAGGAAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019494.1-232s1c1
Sequence:CCGGTGCGACAAAGTTGAAGTGATTCTCGAGAATCACTTCAACTTTGTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019494.1-253s1c1
Sequence:CCGGGTTACTATGAAGGCTCATAAACTCGAGTTTATGAGCCTTCATAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019494.1-206s1c1
Sequence:CCGGCTTCTGTAATTTACCCGAGTACTCGAGTACTCGGGTAAATTACAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019494
CXCL11 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) ligand 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019494.1-310s1c1
Sequence:CCGGCGCCTCATAATGCAGGCAATACTCGAGTATTGCCTGCATTATGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019494.1-121s1c1
Sequence:CCGGCAAGGCTTCCTTATGTTCAAACTCGAGTTTGAACATAAGGAAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019494.1-232s1c1
Sequence:CCGGTGCGACAAAGTTGAAGTGATTCTCGAGAATCACTTCAACTTTGTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019494.1-253s1c1
Sequence:CCGGGTTACTATGAAGGCTCATAAACTCGAGTTTATGAGCCTTCATAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019494.1-206s1c1
Sequence:CCGGCTTCTGTAATTTACCCGAGTACTCGAGTACTCGGGTAAATTACAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019494
CXCL11 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) ligand 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019494.1-310s1c1
Sequence:CCGGCGCCTCATAATGCAGGCAATACTCGAGTATTGCCTGCATTATGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019494.1-121s1c1
Sequence:CCGGCAAGGCTTCCTTATGTTCAAACTCGAGTTTGAACATAAGGAAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019494.1-232s1c1
Sequence:CCGGTGCGACAAAGTTGAAGTGATTCTCGAGAATCACTTCAACTTTGTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019494.1-253s1c1
Sequence:CCGGGTTACTATGAAGGCTCATAAACTCGAGTTTATGAGCCTTCATAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019494.1-206s1c1
Sequence:CCGGCTTCTGTAATTTACCCGAGTACTCGAGTACTCGGGTAAATTACAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks