EMAIL THIS PAGE TO A FRIEND

CXCL12

chemokine (C-X-C motif) ligand 12

329 Gene Product Result for
Synonyms: IRH PBSF SCYB12 SDF1 TLSF TPAR1
Gene ID:
Human(6387) Summary: This gene encodes a stromal cell-derived alpha chemokine member of the intercrine family. The encoded protein functions as the ligand for the G-protein coupled receptor, chemokine (C-X-C motif) receptor 4, and plays a role in many diverse cellular functions, including embryogenesis, immune surveillance, inflammation response, tissue homeostasis, and tumor growth and metastasis. Mutations in this gene are associated with resistance to human immunodeficiency virus type 1 infections. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2013]
Mouse(20315) chemokine (C-X-C motif) ligand 12
Rat(24772) chemokine (C-X-C motif) ligand 12
chicken(395180) chemokine (C-X-C motif) ligand 12
cow(613811) chemokine (C-X-C motif) ligand 12
dog(449622) chemokine (C-X-C motif) ligand 12
domestic cat(493806) chemokine (C-X-C motif) ligand 12
domestic guinea pig(100721137) chemokine (C-X-C motif) ligand 12
sheep(101121145) chemokine (C-X-C motif) ligand 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1412069 ANTI-CXCL12 antibody produced in mouse clone 2E2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412070 ANTI-CXCL12 antibody produced in mouse clone 4D8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412168 ANTI-CXCL12 antibody produced in mouse clone 1B2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412169 ANTI-CXCL12 antibody produced in mouse clone 2A1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412233 ANTI-CXCL12 antibody produced in mouse clone 2B1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2107854 Anti-CXCL12 antibody produced in rabbit affinity isolated antibody bovine, canine, rat, pig
western blot pricing
SAB3501069 Anti-CXCL12 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunocytochemistry, western blot pricing
S192 Anti-SDF-1/PBSF antibody produced in goat affinity isolated antibody, lyophilized powder human
ELISA, neutralization, western blot pricing
S2687 Anti-SDF-1β/PBSF antibody produced in goat affinity isolated antibody, lyophilized powder human
ELISA, neutralization, western blot pricing
WH0006387M1 Monoclonal Anti-CXCL12 antibody produced in mouse clone 1E5, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1404360 Monoclonal Anti-CXCL12 antibody produced in mouse clone 1F10, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

Proteins

Product # Description Species Add to Cart
 
SRP3276 SDF-1 ALPHA human Animal-component free, recombinant, expressed in E. coli, ≥98% (SDS-PAGE), ≥98% (HPLC) human pricing
SRP3277 SDF-1 BETA human Animal-component free, recombinant, expressed in E. coli, ≥98% (SDS-PAGE), ≥98% (HPLC) human pricing
QPREST24636 SILuPrEST SDF1 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution human pricing
S190 Stromal Cell-Derived Factor 1α/pre-B Cell Growth Stimulating Factor human >97% (SDS-PAGE), recombinant, expressed in E. coli, lyophilized powder, cell culture tested human pricing
S8406 Stromal Cell-Derived Factor 1β/pre-B Cell Growth Stimulating Factor human >97% (SDS-PAGE), recombinant, expressed in E. coli, lyophilized powder, cell culture tested human pricing
SRP4388 SDF-1alpha (CXCL12) from mouse recombinant, expressed in E. coli, ≥99% (SDS-PAGE), ≥99% (HPLC) mouse pricing
SRP4391 SDF-1beta (CXCL12) from mouse recombinant, expressed in E. coli, ≥98% (SDS-PAGE), ≥98% (HPLC) mouse pricing
SRP3252 SDF-1 alpha from rat recombinant, expressed in E. coli, ≥98% (SDS-PAGE), ≥98% (HPLC), cell culture tested rat pricing
SRP3253 SDF-1 beta from rat recombinant, expressed in E. coli, ≥95% (SDS-PAGE), ≥95% (HPLC), cell culture tested rat pricing
SRP6235 SDF-1α/CXCL2 from rat recombinant, expressed in E. coli, ≥98% (SDS-PAGE) rat pricing
SRP6236 SDF-1β/CXCL2 from rat recombinant, expressed in E. coli, ≥95% (SDS-PAGE) rat pricing
S5816 Stromal Cell-Derived Factor 1α/pre-B Cell Growth Stimulating Factor from mouse SDF-1α, recombinant, expressed in E. coli, powder, cell culture tested pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013655 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013655 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013655 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000609 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000609 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000609 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000609 Rosetta Predictions human pricing
NM_001033886 Rosetta Predictions human pricing
NM_199168 Rosetta Predictions human pricing
NM_001033882 Rosetta Predictions rat pricing
NM_001033883 Rosetta Predictions rat pricing
NM_022177 Rosetta Predictions rat pricing
NM_001012477 Rosetta Predictions mouse pricing
NM_013655 Rosetta Predictions mouse pricing
NM_021704 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000609 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073752 predicted 601
2 SASI_Hs01_00073753 predicted 512
3 SASI_Hs01_00073754 predicted 798
4 SASI_Hs01_00073755 predicted 590
5 SASI_Hs01_00073756 predicted 295
6 SASI_Hs01_00073757 predicted 610
7 SASI_Hs01_00073758 predicted 805
8 SASI_Hs02_00302916 predicted 660
9 SASI_Hs01_00073760 predicted 593
10 SASI_Hs01_00073761 predicted 593
11 SASI_Hs01_00073759 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033886 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217124 predicted 152
2 SASI_Hs02_00308103 predicted 196
3 SASI_Hs02_00308104 predicted 184
4 SASI_Hs01_00217126 predicted 291
5 SASI_Hs01_00217127 predicted 300
6 SASI_Hs02_00308105 predicted 150
7 SASI_Hs02_00308106 predicted 167
8 SASI_Hs02_00308107 predicted 176
9 SASI_Hs02_00308108 predicted 254
10 SASI_Hs02_00308109 predicted 177
11 SASI_Hs01_00217123 predicted 152
12 SASI_Hs01_00217125 predicted 325
13 SASI_Hs01_00217128 predicted 247
14 SASI_Hs01_00217129 predicted 219
15 SASI_Hs01_00217130 predicted 251
16 SASI_Hs01_00217131 predicted 213
17 SASI_Hs01_00217132 predicted 272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199168 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046379 predicted 723
2 SASI_Hs01_00046381 predicted 545
3 SASI_Hs01_00046383 predicted 720
4 SASI_Hs01_00046384 predicted 289
5 SASI_Hs01_00046385 predicted 381
6 SASI_Hs01_00046386 predicted 658
7 SASI_Hs01_00046387 predicted 619
8 SASI_Hs02_00372602 predicted 407
9 SASI_Hs02_00372603 predicted 536
10 SASI_Hs02_00372604 predicted 381
11 SASI_Hs01_00046378 predicted 332
12 SASI_Hs01_00046380 predicted 350
13 SASI_Hs01_00046382 predicted 545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033882 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203773 predicted 605
2 SASI_Rn01_00115967 predicted 557
3 SASI_Rn01_00115968 predicted 521
4 SASI_Rn01_00115969 predicted 498
5 SASI_Rn01_00115970 predicted 552
6 SASI_Rn01_00115971 predicted 285
7 SASI_Rn01_00115972 predicted 503
8 SASI_Rn01_00115973 predicted 238
9 SASI_Rn01_00115974 predicted 245
10 SASI_Rn02_00203774 predicted 608
11 SASI_Rn01_00115975 predicted 298
12 SASI_Rn01_00115976 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033883 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030111 predicted 650
2 SASI_Rn01_00030112 predicted 195
3 SASI_Rn01_00030113 predicted 229
4 SASI_Rn01_00030114 predicted 282
5 SASI_Rn02_00203775 predicted 310
6 SASI_Rn01_00030115 predicted 317
7 SASI_Rn01_00030117 predicted 248
8 SASI_Rn01_00030118 predicted 294
9 SASI_Rn01_00030119 predicted 117
10 SASI_Rn02_00203776 predicted 468
11 SASI_Rn01_00030116 predicted 800
12 SASI_Rn01_00030120 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022177 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094531 predicted 195
2 SASI_Rn01_00094532 predicted 603
3 SASI_Rn01_00094533 predicted 514
4 SASI_Rn01_00094534 predicted 232
5 SASI_Rn01_00094536 predicted 622
6 SASI_Rn01_00094537 predicted 327
7 SASI_Rn01_00094538 predicted 478
8 SASI_Rn01_00094539 predicted 808
9 SASI_Rn02_00262918 predicted 352
10 SASI_Rn01_00094540 predicted 846
11 SASI_Rn01_00094535 predicted 287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012477 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055016 predicted 645
2 SASI_Mm01_00055017 predicted 679
3 SASI_Mm01_00055018 predicted 134
4 SASI_Mm01_00055019 predicted 330
5 SASI_Mm01_00055020 predicted 293
6 SASI_Mm01_00055021 predicted 675
7 SASI_Mm01_00055022 predicted 545
8 SASI_Mm01_00055023 predicted 327
9 SASI_Mm01_00055024 predicted 199
10 SASI_Mm02_00287119 predicted 306
11 SASI_Mm01_00055025 predicted 803
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013655 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060887 predicted 311
2 SASI_Mm01_00060888 predicted 288
3 SASI_Mm01_00060889 predicted 360
4 SASI_Mm01_00060890 predicted 335
5 SASI_Mm01_00060891 predicted 139
6 SASI_Mm01_00060892 predicted 376
7 SASI_Mm01_00060893 predicted 710
8 SASI_Mm01_00060894 predicted 300
9 SASI_Mm01_00060895 predicted 612
10 SASI_Mm01_00060896 predicted 195
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021704 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198963 predicted 539
2 SASI_Mm01_00198964 predicted 336
3 SASI_Mm01_00198965 predicted 856
4 SASI_Mm01_00198966 predicted 293
5 SASI_Mm01_00198967 predicted 808
6 SASI_Mm01_00198968 predicted 698
7 SASI_Mm02_00326388 predicted 195
8 SASI_Mm01_00198969 predicted 333
9 SASI_Mm01_00198970 predicted 622
10 SASI_Mm01_00198971 predicted 309
11 SASI_Mm01_00198972 predicted 499
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013655
VALIDATED
CXCL12 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) ligand 12
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013655.3-327s21c1
Sequence:CCGGGATCCAAGAGTACCTGGAGAACTCGAGTTCTCCAGGTACTCTTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013655.3-217s21c1
Sequence:CCGGGCCAACGTCAAGCATCTGAAACTCGAGTTTCAGATGCTTGACGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013655.3-280s21c1
Sequence:CCGGCTGAAGAACAACAACAGACAACTCGAGTTGTCTGTTGTTGTTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013655.3-144s21c1
Sequence:CCGGCATCAGTGACGGTAAACCAGTCTCGAGACTGGTTTACCGTCACTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013655.2-319s1c1
Sequence:CCGGCAAGAGTACCTGGAGAAAGCTCTCGAGAGCTTTCTCCAGGTACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013655.2-268s1c1
Sequence:CCGGCTGAAGAACAACAACAGACAACTCGAGTTGTCTGTTGTTGTTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013655.2-205s1c1
Sequence:CCGGGCCAACGTCAAGCATCTGAAACTCGAGTTTCAGATGCTTGACGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013655.2-132s1c1
Sequence:CCGGCATCAGTGACGGTAAACCAGTCTCGAGACTGGTTTACCGTCACTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013655.2-315s1c1
Sequence:CCGGGATCCAAGAGTACCTGGAGAACTCGAGTTCTCCAGGTACTCTTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013655
VALIDATED
CXCL12 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) ligand 12
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013655.3-327s21c1
Sequence:CCGGGATCCAAGAGTACCTGGAGAACTCGAGTTCTCCAGGTACTCTTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013655.3-217s21c1
Sequence:CCGGGCCAACGTCAAGCATCTGAAACTCGAGTTTCAGATGCTTGACGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013655.3-280s21c1
Sequence:CCGGCTGAAGAACAACAACAGACAACTCGAGTTGTCTGTTGTTGTTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013655.3-144s21c1
Sequence:CCGGCATCAGTGACGGTAAACCAGTCTCGAGACTGGTTTACCGTCACTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013655.2-319s1c1
Sequence:CCGGCAAGAGTACCTGGAGAAAGCTCTCGAGAGCTTTCTCCAGGTACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013655.2-268s1c1
Sequence:CCGGCTGAAGAACAACAACAGACAACTCGAGTTGTCTGTTGTTGTTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013655.2-205s1c1
Sequence:CCGGGCCAACGTCAAGCATCTGAAACTCGAGTTTCAGATGCTTGACGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013655.2-132s1c1
Sequence:CCGGCATCAGTGACGGTAAACCAGTCTCGAGACTGGTTTACCGTCACTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013655.2-315s1c1
Sequence:CCGGGATCCAAGAGTACCTGGAGAACTCGAGTTCTCCAGGTACTCTTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013655
VALIDATED
CXCL12 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) ligand 12
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013655.3-327s21c1
Sequence:CCGGGATCCAAGAGTACCTGGAGAACTCGAGTTCTCCAGGTACTCTTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013655.3-217s21c1
Sequence:CCGGGCCAACGTCAAGCATCTGAAACTCGAGTTTCAGATGCTTGACGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013655.3-280s21c1
Sequence:CCGGCTGAAGAACAACAACAGACAACTCGAGTTGTCTGTTGTTGTTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013655.3-144s21c1
Sequence:CCGGCATCAGTGACGGTAAACCAGTCTCGAGACTGGTTTACCGTCACTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013655.2-319s1c1
Sequence:CCGGCAAGAGTACCTGGAGAAAGCTCTCGAGAGCTTTCTCCAGGTACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013655.2-268s1c1
Sequence:CCGGCTGAAGAACAACAACAGACAACTCGAGTTGTCTGTTGTTGTTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013655.2-205s1c1
Sequence:CCGGGCCAACGTCAAGCATCTGAAACTCGAGTTTCAGATGCTTGACGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013655.2-132s1c1
Sequence:CCGGCATCAGTGACGGTAAACCAGTCTCGAGACTGGTTTACCGTCACTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013655.2-315s1c1
Sequence:CCGGGATCCAAGAGTACCTGGAGAACTCGAGTTCTCCAGGTACTCTTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000609
VALIDATED
CXCL12 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) ligand 12
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000609.4-247s21c1
Sequence:CCGGCAAACTGTGCCCTTCAGATTGCTCGAGCAATCTGAAGGGCACAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000609.4-361s21c1
Sequence:CCGGTCAAGATGTGAGAGGGTCAGACTCGAGTCTGACCCTCTCACATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000609.4-344s21c1
Sequence:CCGGAGCTTTAAACAAGAGGTTCAACTCGAGTTGAACCTCTTGTTTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000609.4-179s21c1
Sequence:CCGGCCCATGCCGATTCTTCGAAAGCTCGAGCTTTCGAAGAATCGGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000609.4-597s21c1
Sequence:CCGGGCTTAGACTAAGGCCATTATTCTCGAGAATAATGGCCTTAGTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000609.4-2249s21c1
Sequence:CCGGCTCTCACTATACCAGTATAATCTCGAGATTATACTGGTATAGTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000609.4-157s21c1
Sequence:CCGGCCGTCAGCCTGAGCTACAGATCTCGAGATCTGTAGCTCAGGCTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000609.4-234s21c1
Sequence:CCGGATTCTCAACACTCCAAACTGTCTCGAGACAGTTTGGAGTGTTGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000609.4-193s21c1
Sequence:CCGGTCGAAAGCCATGTTGCCAGAGCTCGAGCTCTGGCAACATGGCTTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000609.x-288s1c1
Sequence:CCGGTGTGCATTGACCCGAAGCTAACTCGAGTTAGCTTCGGGTCAATGCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000609.x-304s1c1
Sequence:CCGGGCTAAAGTGGATTCAGGAGTACTCGAGTACTCCTGAATCCACTTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000609.x-203s1c1
Sequence:CCGGGCCAACGTCAAGCATCTCAAACTCGAGTTTGAGATGCTTGACGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003314    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000609.x-599s1c1
Sequence:CCGGGCCATTATTGTACTTGCCTTACTCGAGTAAGGCAAGTACAATAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000609.x-320s1c1
Sequence:CCGGGAGTACCTGGAGAAAGCTTTACTCGAGTAAAGCTTTCTCCAGGTACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000609
VALIDATED
CXCL12 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) ligand 12
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000609.4-247s21c1
Sequence:CCGGCAAACTGTGCCCTTCAGATTGCTCGAGCAATCTGAAGGGCACAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000609.4-361s21c1
Sequence:CCGGTCAAGATGTGAGAGGGTCAGACTCGAGTCTGACCCTCTCACATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000609.4-344s21c1
Sequence:CCGGAGCTTTAAACAAGAGGTTCAACTCGAGTTGAACCTCTTGTTTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000609.4-179s21c1
Sequence:CCGGCCCATGCCGATTCTTCGAAAGCTCGAGCTTTCGAAGAATCGGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000609.4-597s21c1
Sequence:CCGGGCTTAGACTAAGGCCATTATTCTCGAGAATAATGGCCTTAGTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000609.4-2249s21c1
Sequence:CCGGCTCTCACTATACCAGTATAATCTCGAGATTATACTGGTATAGTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000609.4-157s21c1
Sequence:CCGGCCGTCAGCCTGAGCTACAGATCTCGAGATCTGTAGCTCAGGCTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000609.4-234s21c1
Sequence:CCGGATTCTCAACACTCCAAACTGTCTCGAGACAGTTTGGAGTGTTGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000609.4-193s21c1
Sequence:CCGGTCGAAAGCCATGTTGCCAGAGCTCGAGCTCTGGCAACATGGCTTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000609.x-288s1c1
Sequence:CCGGTGTGCATTGACCCGAAGCTAACTCGAGTTAGCTTCGGGTCAATGCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000609.x-304s1c1
Sequence:CCGGGCTAAAGTGGATTCAGGAGTACTCGAGTACTCCTGAATCCACTTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000609.x-203s1c1
Sequence:CCGGGCCAACGTCAAGCATCTCAAACTCGAGTTTGAGATGCTTGACGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003314    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000609.x-599s1c1
Sequence:CCGGGCCATTATTGTACTTGCCTTACTCGAGTAAGGCAAGTACAATAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000609.x-320s1c1
Sequence:CCGGGAGTACCTGGAGAAAGCTTTACTCGAGTAAAGCTTTCTCCAGGTACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000609
VALIDATED
CXCL12 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) ligand 12
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000609.4-247s21c1
Sequence:CCGGCAAACTGTGCCCTTCAGATTGCTCGAGCAATCTGAAGGGCACAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000609.4-361s21c1
Sequence:CCGGTCAAGATGTGAGAGGGTCAGACTCGAGTCTGACCCTCTCACATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000609.4-344s21c1
Sequence:CCGGAGCTTTAAACAAGAGGTTCAACTCGAGTTGAACCTCTTGTTTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000609.4-179s21c1
Sequence:CCGGCCCATGCCGATTCTTCGAAAGCTCGAGCTTTCGAAGAATCGGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000609.4-597s21c1
Sequence:CCGGGCTTAGACTAAGGCCATTATTCTCGAGAATAATGGCCTTAGTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000609.4-2249s21c1
Sequence:CCGGCTCTCACTATACCAGTATAATCTCGAGATTATACTGGTATAGTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000609.4-157s21c1
Sequence:CCGGCCGTCAGCCTGAGCTACAGATCTCGAGATCTGTAGCTCAGGCTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000609.4-234s21c1
Sequence:CCGGATTCTCAACACTCCAAACTGTCTCGAGACAGTTTGGAGTGTTGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000609.4-193s21c1
Sequence:CCGGTCGAAAGCCATGTTGCCAGAGCTCGAGCTCTGGCAACATGGCTTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000609.x-288s1c1
Sequence:CCGGTGTGCATTGACCCGAAGCTAACTCGAGTTAGCTTCGGGTCAATGCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000609.x-304s1c1
Sequence:CCGGGCTAAAGTGGATTCAGGAGTACTCGAGTACTCCTGAATCCACTTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000609.x-203s1c1
Sequence:CCGGGCCAACGTCAAGCATCTCAAACTCGAGTTTGAGATGCTTGACGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003314    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000609.x-599s1c1
Sequence:CCGGGCCATTATTGTACTTGCCTTACTCGAGTAAGGCAAGTACAATAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000609.x-320s1c1
Sequence:CCGGGAGTACCTGGAGAAAGCTTTACTCGAGTAAAGCTTTCTCCAGGTACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks